Sds

Lab Reagents

Sds Laboratories manufactures the sds reagents distributed by Genprice. The Sds reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Sds. Other Sds products are available in stock. Specificity: Sds Category:

Lab Tools information

10% SDS

TG4060 1ml
EUR 134.00

anti-SDS

YF-PA17352 50 ug
EUR 363.00
Description: Mouse polyclonal to SDS

dAbs scaffold protein anti-Human B5R

SDS-L073 1 mg
EUR 4496.00
Description: Scaffold protein

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution

A0030 4L
EUR 94.80
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TT-SDS (Tris-Tricine-SDS buffer) Premix powder

TD8135 1PK, 10L
EUR 76.10
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4

UA0030 500ml
EUR 67.40
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS cloning plasmid

CSB-CL020926HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
  • Show more
Description: A cloning plasmid for the SDS gene.

SDS Blocking Peptide

33R-4446 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide

33R-1011 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS Polyclonal Antibody

27842-100ul 100ul
EUR 252.00

SDS Polyclonal Antibody

27842-50ul 50ul
EUR 187.00

SDS Rabbit pAb

A12898-100ul 100 ul
EUR 308.00

SDS Rabbit pAb

A12898-200ul 200 ul
EUR 459.00

SDS Rabbit pAb

A12898-20ul 20 ul
EUR 183.00

SDS Rabbit pAb

A12898-50ul 50 ul
EUR 223.00

100G SDS Ultrapure

NAT1072 100G
EUR 93.00

1KG SDS Ultrapure

NAT1074 1KG
EUR 306.00