Sars Cov2 detection

SARS antibody

39139-100ul SAB 100ul 252 EUR

SARS antibody

70R-20086 Fitzgerald 50 ul 435 EUR
Description: Rabbit polyclonal SARS antibody

SARS antibody

70R-1444 Fitzgerald 100 ug 377 EUR
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 Fitzgerald 100 ug 377 EUR
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS


20-abx932473 Abbexa
  • 551.00 EUR
  • 732.00 EUR
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


20-abx932474 Abbexa
  • 551.00 EUR
  • 732.00 EUR
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS Antibody

1-CSB-PA04145A0Rb Cusabio
  • 317.00 EUR
  • 335.00 EUR
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU Cusabio
  • 597.00 EUR
  • 333.00 EUR
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


PVT12269 Lifescience Market 2 ug 391 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg EnQuireBio 1mg 1261 EUR

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg EnQuireBio 1mg 3954 EUR

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug EnQuireBio 20ug 201 EUR

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug EnQuireBio 5ug 155 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug EnQuireBio 500ug 663 EUR

SARS Conjugated Antibody

C39139 SAB 100ul 397 EUR

SARS cloning plasmid

CSB-CL020709HU1-10ug Cusabio 10ug 376 EUR
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug Cusabio 10ug 376 EUR
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Protease Substrate

H-5982.0500 Bachem 0.5mg 297 EUR
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 Bachem 1.0mg 515 EUR
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

anti- SARS antibody

FNab07609 FN Test 100µg 548.75 EUR
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: seryl-tRNA synthetase
  • Uniprot ID: P49591
  • Gene ID: 6301
  • Research Area: Metabolism
Description: Antibody raised against SARS

SARS Spike Antibody

20-abx137200 Abbexa
  • 1177.00 EUR
  • 1887.00 EUR
  • 2221.00 EUR
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201 Abbexa
  • 1177.00 EUR
  • 1887.00 EUR
  • 2221.00 EUR
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184 Abbexa
  • 1052.00 EUR
  • 1539.00 EUR
  • 1720.00 EUR
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185 Abbexa
  • 1052.00 EUR
  • 1539.00 EUR
  • 1970.00 EUR
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS-E2 Antibody

abx016055-100ul Abbexa 100 ul 411 EUR
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul Abbexa 100 ul 411 EUR
  • Shipped within 5-10 working days.

SARS Polyclonal Antibody

A53977 EpiGentek 100 µg 570.55 EUR
Description: The best epigenetics products

SARS Rabbit pAb

A13350-100ul Abclonal 100 ul 308 EUR

SARS Rabbit pAb

A13350-200ul Abclonal 200 ul 459 EUR

SARS Rabbit pAb

A13350-20ul Abclonal 20 ul 183 EUR

SARS Rabbit pAb

A13350-50ul Abclonal 50 ul 223 EUR

SARS Rabbit pAb

A6733-100ul Abclonal 100 ul 308 EUR

SARS Rabbit pAb

A6733-200ul Abclonal 200 ul 459 EUR

SARS Rabbit pAb

A6733-20ul Abclonal 20 ul 183 EUR

SARS Rabbit pAb

A6733-50ul Abclonal 50 ul 223 EUR

SARS Blocking Peptide

33R-7048 Fitzgerald 100 ug 180 EUR
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS Blocking Peptide

33R-8713 Fitzgerald 100 ug 180 EUR
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Coronavirus antibody

10C-CR9003M1 Fitzgerald 100 ug 499 EUR
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 Fitzgerald 100 ug 435 EUR
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 Fitzgerald 100 ug 435 EUR
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS E2 antibody

10R-1976 Fitzgerald 100 ul 241 EUR
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 Fitzgerald 100 ul 241 EUR
Description: Mouse monoclonal SARS M antibody

SARS Spike Antibody

24216-100ul SAB 100ul 390 EUR

SARS Spike Antibody

24217-100ul SAB 100ul 390 EUR

SARS Spike Antibody

24218-100ul SAB 100ul 390 EUR

SARS Spike Antibody

24219-100ul SAB 100ul 390 EUR

SARS Spike Antibody

24318-100ul SAB 100ul 390 EUR

SARS Matrix Antibody

24319-100ul SAB 100ul 390 EUR

SARS Matrix Antibody

24320-100ul SAB 100ul 390 EUR

SARS Envelope Antibody

24321-100ul SAB 100ul 390 EUR

SARS Envelope Antibody

24322-100ul SAB 100ul 390 EUR

SARS S1 [His]

DAG1861 Creative Diagnostics 500 ug 2529 EUR

SARS S2 [His]

DAG1862 Creative Diagnostics 500 ug 2529 EUR

Anti-SARS antibody

PAab07609 Lifescience Market 100 ug 386 EUR

Anti-SARS antibody

STJ28816 St John's Laboratory 100 µl 277 EUR
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 St John's Laboratory 100 µl 277 EUR
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 Abfrontier 100 ug 363 EUR
Description: Mouse monoclonal to SARS

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug

QP13420-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg

QP13420-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug

QP13420-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug

QP13421-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg

QP13421-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug

QP13421-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug

QP13422-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg

QP13422-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug

QP13422-500ug EnQuireBio 500ug 663 EUR

Polyclonal SARS Matrix Antibody

APR11178G Leading Biology 0.1 mg 659 EUR
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Polyclonal SARS Matrix Antibody

APG02976G Leading Biology 0.1 mg 659 EUR
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Rat SARS shRNA Plasmid

20-abx988123 Abbexa
  • 801.00 EUR
  • 1121.00 EUR
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002719 Lifescience Market 96 Tests 689 EUR

SARS CoV E Protein

abx060650-1mg Abbexa 1 mg 1692 EUR
  • Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein

abx060652-1mg Abbexa 1 mg 1873 EUR
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060653-1mg Abbexa 1 mg 1692 EUR
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060654-1mg Abbexa 1 mg 1692 EUR
  • Shipped within 5-10 working days.

SARS-CoV Spike Protein

abx060655-1mg Abbexa 1 mg 1692 EUR
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul Abbexa 400 ul 523 EUR
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-80l Abbexa 80 µl 286 EUR
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-400ul Abbexa 400 ul 523 EUR
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-80l Abbexa 80 µl 286 EUR
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-400ul Abbexa 400 ul 523 EUR
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-80l Abbexa 80 µl 286 EUR
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018255-100ug Abbexa 100 ug 384 EUR
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug Abbexa 100 ug 384 EUR
  • Shipped within 5-10 working days.

Human SARS shRNA Plasmid

20-abx954245 Abbexa
  • 801.00 EUR
  • 1121.00 EUR
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SARS protein (His tag)

80R-2099 Fitzgerald 50 ug 322 EUR
Description: Recombinant human SARS protein (His tag)

Mouse SARS shRNA Plasmid

20-abx972567 Abbexa
  • 801.00 EUR
  • 1121.00 EUR
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SARS Antibody, HRP conjugated

1-CSB-PA04145B0Rb Cusabio
  • 317.00 EUR
  • 335.00 EUR
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

1-CSB-PA04145C0Rb Cusabio
  • 317.00 EUR
  • 335.00 EUR
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

1-CSB-PA04145D0Rb Cusabio
  • 317.00 EUR
  • 335.00 EUR
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti-SARS-E2 (4A6C9)

LF-MA30016 Abfrontier 100 ul 344 EUR
Description: Mouse Monoclonal to SARS-E2

anti-SARS-M (2H2C4)

LF-MA30017 Abfrontier 100 ul 354 EUR
Description: Mouse Monoclonal to SARS-M

SARS Recombinant Protein (Human)

RP027604 ABM 100 ug Ask for price

SARS Recombinant Protein (Human)

RP027607 ABM 100 ug Ask for price

SARS Recombinant Protein (Rat)

RP227480 ABM 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170009 ABM 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170012 ABM 100 ug Ask for price

Anti-SARS-E2 antibody

STJ98377 St John's Laboratory 100 µl 234 EUR
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody

STJ98378 St John's Laboratory 100 µl 234 EUR
Description: Mouse monoclonal to SARS-M.

Recombinant SARS Matrix Protein

VAng-Lsx0059-inquire Creative Biolabs inquire Ask for price
Description: SARS Matrix, recombinant protein from E. coli.

SARS-CoV spike protein Antibody

abx023139-100ug Abbexa 100 ug 857 EUR
  • Shipped within 5-10 working days.

SARS-CoV spike protein Antibody

abx023143-100ug Abbexa 100 ug 857 EUR
  • Shipped within 5-10 working days.

SARS Associated Coronavirus Matrix Protein

20-abx260150 Abbexa
  • 885.00 EUR
  • 342.00 EUR
  • 1372.00 EUR
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

SARS Associated Coronavirus Envelope Protein

20-abx260151 Abbexa
  • 885.00 EUR
  • 342.00 EUR
  • 1372.00 EUR
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

SARS Polyclonal Antibody, HRP Conjugated

A53978 EpiGentek 100 µg 570.55 EUR
Description: kits suitable for this type of research

SARS Polyclonal Antibody, FITC Conjugated

A53979 EpiGentek 100 µg 570.55 EUR
Description: fast delivery possible

SARS Polyclonal Antibody, Biotin Conjugated

A53980 EpiGentek 100 µg 570.55 EUR
Description: reagents widely cited

Recombinant SARS Associated Coronavirus Matrix

7-07114 CHI Scientific 100µg Ask for price

Recombinant SARS Associated Coronavirus Matrix

7-07115 CHI Scientific 500µg Ask for price

Recombinant SARS Associated Coronavirus Matrix

7-07116 CHI Scientific 1000µg Ask for price