Lab Reagents
P2Ry8 Laboratories manufactures the p2ry8 (abp52106 reagents distributed by Genprice. The P2Ry8 (Abp52106 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact P2Ry8. Other P2Ry8 products are available in stock. Specificity: P2Ry8 Category: (Abp52106
Lab Tools information
P2RY8 Polyclonal Antibody |
41301-50ul | SAB | 50ul | EUR 187 |
P2RY8 Blocking Peptide |
DF5137-BP | Affbiotech | 1mg | EUR 195 |
P2RY8 cloning plasmid |
CSB-CL773043HU-10ug | Cusabio | 10ug | EUR 412 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1080
- Sequence: atgcaggtcccgaacagcaccggcccggacaacgcgacgctgcagatgctgcggaacccggcgatcgcggtggccctgcccgtggtgtactcgctggtggcggcggtcagcatcccgggcaacctcttctctctgtgggtgctgtgccggcgcatggggcccagatccccgtcgg
- Show more
|
Description: A cloning plasmid for the P2RY8 gene. |
P2RY8 Rabbit pAb |
A17850-100ul | Abclonal | 100 ul | EUR 308 |
P2RY8 Rabbit pAb |
A17850-200ul | Abclonal | 200 ul | EUR 459 |
P2RY8 Rabbit pAb |
A17850-20ul | Abclonal | 20 ul | EUR 183 |
P2RY8 Rabbit pAb |
A17850-50ul | Abclonal | 50 ul | EUR 223 |
P2RY8 Polyclonal Antibody |
ES3105-100ul | ELK Biotech | 100ul | EUR 279 |
Description: A Rabbit Polyclonal antibody against P2RY8 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA |
P2RY8 Polyclonal Antibody |
ES3105-50ul | ELK Biotech | 50ul | EUR 207 |
Description: A Rabbit Polyclonal antibody against P2RY8 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA |
Anti-P2RY8 antibody |
STJ119863 | St John's Laboratory | 100 µl | EUR 277 |
Description: The protein encoded by this gene belongs to the family of G-protein coupled receptors, that are preferentially activated by adenosine and uridine nucleotides. This gene is moderately expressed in undifferentiated HL60 cells, and is located on both chromosomes X and Y. [provided by RefSeq, Jul 2008] |
Anti-P2RY8 antibody |
STJ94869 | St John's Laboratory | 200 µl | EUR 197 |
Description: Rabbit polyclonal to P2RY8. |
Anti-P2RY8/P2Y8 Antibody |
A11574 | BosterBio | 100ul | EUR 397 |
Description: Rabbit Polyclonal Antibody for P2RY8 Antibody (P2RY8) detection.tested for WB in Human. |
Human P2RY8 shRNA Plasmid |
20-abx967177 | Abbexa | | |
- Shipped within 15-20 working days.
|
P2RY8 Polyclonal Conjugated Antibody |
C41301 | SAB | 100ul | EUR 397 |
P2RY8 Recombinant Protein (Human) |
RP022375 | ABM | 100 ug | Ask for price |
P2RY8 ORF Vector (Human) (pORF) |
ORF007459 | ABM | 1.0 ug DNA | EUR 95 |
Polyclonal P2RY8 / P2Y8 Antibody (C-Terminus) |
APR12688G | Leading Biology | 0.05mg | EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY8 / P2Y8 (C-Terminus). This antibody is tested and proven to work in the following applications: |