P2Ry8 (Abp52106

Lab Reagents

P2Ry8 Laboratories manufactures the p2ry8 (abp52106 reagents distributed by Genprice. The P2Ry8 (Abp52106 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact P2Ry8. Other P2Ry8 products are available in stock. Specificity: P2Ry8 Category: (Abp52106

Lab Tools information

P2RY8 Polyclonal Antibody

ES3105-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P2RY8 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

P2RY8 Rabbit pAb

A17850-100ul 100 ul
EUR 308

P2RY8 Rabbit pAb

A17850-200ul 200 ul
EUR 459

P2RY8 Rabbit pAb

A17850-20ul 20 ul
EUR 183

P2RY8 Rabbit pAb

A17850-50ul 50 ul
EUR 223

P2RY8 Polyclonal Antibody

41301-100ul 100ul
EUR 252

P2RY8 Polyclonal Antibody

41301-50ul 50ul
EUR 187

P2RY8 Blocking Peptide

DF5137-BP 1mg
EUR 195

P2RY8 cloning plasmid

CSB-CL773043HU-10ug 10ug
EUR 412
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1080
  • Sequence: atgcaggtcccgaacagcaccggcccggacaacgcgacgctgcagatgctgcggaacccggcgatcgcggtggccctgcccgtggtgtactcgctggtggcggcggtcagcatcccgggcaacctcttctctctgtgggtgctgtgccggcgcatggggcccagatccccgtcgg
  • Show more
Description: A cloning plasmid for the P2RY8 gene.

Anti-P2RY8 antibody

STJ94869 200 µl
EUR 197
Description: Rabbit polyclonal to P2RY8.

Anti-P2RY8 antibody

STJ119863 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the family of G-protein coupled receptors, that are preferentially activated by adenosine and uridine nucleotides. This gene is moderately expressed in undifferentiated HL60 cells, and is located on both chromosomes X and Y. [provided by RefSeq, Jul 2008]

P2RY8 Polyclonal Conjugated Antibody

C41301 100ul
EUR 397

Anti-P2RY8/P2Y8 Antibody

A11574 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for P2RY8 Antibody (P2RY8) detection.tested for WB in Human.

Human P2RY8 shRNA Plasmid

20-abx967177
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

P2RY8 Recombinant Protein (Human)

RP022375 100 ug Ask for price

P2RY8 ORF Vector (Human) (pORF)

ORF007459 1.0 ug DNA
EUR 95

Polyclonal P2RY8 / P2Y8 Antibody (C-Terminus)

APR12688G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY8 / P2Y8 (C-Terminus). This antibody is tested and proven to work in the following applications: