Microplate based CLIA and magnetic particles

The In vitro diagnostic products POCT(Point of Care Test), Microbiology and Biochemistry are ISO9001 and EN ISO13485 CE certrified.

SARS-CoV-2 CLIA Microparticles

100T/kit

  1. Anti-SARS-CoV-2 RBD
  2. SARS-CoV-2 Neutralization Antibody (Qualitative)
  3. SARS-CoV-2 NAb Q (Quantitative)
  4. SARS-CoV-2 IgA
  5. CMU0402 SARS-CoV-2 IgM Ⅱ 100T/kit
  6. CMU0302 SARS-CoV-2 IgG Ⅱ 100T/kit
Sars

ELISA

  1. E1701 SARS-CoV-2 IgM 96T/kit
  2. E1601 SARS-CoV-2 IgG 96T/kit
  3. E1501 Anti-SARS-CoV-2 RBD 96T/kit
  4. E1401 SARS-CoV-2 NAb 96T/kit

Rapid Test (Colloidal Gold)

40T/kit

  1. Anti-SARS-CoV-2
  2. SARS-CoV-2 Ag
  3. Anti-SARS-CoV-2 RBD
  4. SARS-CoV-2 IgA
  5. SARS-CoV-2 NAb
  6. Influenza/SARS-CoV-2 Ag Combo
sars

Biochemistry Markers CLIA

  1. AFP
  2. CEA
  3. tPSA
  4. CA50
  5. fPSA
  6. CA125
  7. CA15-3
  8. CA19-9
  9. Ferritin
  10. ¤32-Microglobulin
  11. NSE
  12. CYFRA 21-1
  13. SCCA
  14. CA72-4
  15. Tumor Markers
  16. CMC0602
  17. CMC0702
  18. CMC1002
  19. CMC1102
  20. CMJ0102
  21. Anti-HCV
  22. HAV IgM
  23. HEV IgM
  24. HEV IgG
  25. Anti-HIV

100T

  • CMJ0202 Anti-TP 100T
  • CMJ0103 HIV Ag/Ab Combo 100T

Infectious Diseases

  1. Hypertension
  2. Aldosterone
  3. ACTH
  4. Cortisol
  5. Renin
  6. Angiotensin II

Autobio CLIA Microparticles Product List

Bone Metabolism

  1. Osteocalcin
  2. Calcitonin
  3. Pepsinogen I
  4. Pepsinogen II
  5. T3
  6. T4
  7. TSH
  8. FT3
  9. FT4
  10. Anti-TG
  11. Anti-TPO
  12. TG
  13. PTH
  14. rT3*
  15. Thyroid
  16. HBsAg
  17. Anti-HBs
  18. HBeAg
  19. Anti-HBe
  20. Anti-HBc
  21. HBV PreS1-Ag
  22. Anti-HBc IgM
  23. Endocrine Hormone
  24. LH
  25. FSH
  26. PRL
  27. Testosterone
  28. E2
  29. PRG
  30. DHEA-S
  31. SHBG
  32. 17α-OHP
  33. AMH
  34. TORCH
  35. Toxo IgM
  36. CMV IgM
  37. Rubella IgM
  38. HSV-1 IgM
  39. HSV-2 IgM
  40. Toxo IgG
  41. CMV IgG
  42. Rubella IgG
  43. HSV-1 IgG
  44. HSV-2 IgG
  45. Chemiluminisent Substrate
  46. Diluent Universal
  47. System Wash
  48. Sample Cup
  49. Reaction Vessel
  50. Pre-natal
  51. Free ¤-HCG
  52. P–AFP
  53. ¤- HCG
  54. uE3
  55. PAPP-A
  56. MYO
  57. cTnI
  58. CK-MB
  59. NT-proBNP
  60. BNP*
  61. HS-cTnI*
  62. Diabetes
  63. CMG0102
  64. CMG0202
  65. Insulin
  66. C-Peptide
  67. IGF-1
  68. HGH
  69. Growth Hormone
  70. Hepato Fibrosis
  71. PIIINP
  72. Col 5
  73. LN
  74. HA
  75. CG*

Inflammation Monitoring

CMR0102 hs-CRP 100T

Coming Soon

Anemia CMS0302 Vitamin B12 100T Anemia CL0212-2 Ferritin 96T 96T 96T 96T 96T Hepato Fibrosis CL0315-2 CL0316-2 CL0317-2 CL0318-2 HA LN PⅢ Col Ⅳ CLIA Microplate Autobio Product List Thyroid 96T 96T 96T 96T 96T 96T 96T T3 T4 TSH FT3 FT4 Anti-TG Anti-TPO CL1001-2 CL1002-2 CL1003-2 CL1004-2 CL1005-2 CL1006-2 CL1007-2 96T 96T 96T 96T 96T 96T 96T 96T HBsAg Anti-HBs HBeAg Anti-HBe Anti-HBc Anti-HIV Anti-HCV Anti-TP CL0310-2 CL0311-2 CL0312-2 CL0313-2 CL0314-2 CLK0101 CLK0201 CLK0301 Tumor Markers 96T 96T 96T 96T 96T 96T 96T 96T AFP CEA tPSA CA50 fPSA CA125 CA15-3 CA19-9 CL0203-2 CL0205-2 CL0206-2 CL0207-2 CL0208-2 CL0209-2 CL0210-2 CL0211-2 ELISA Infectious Diseases HAV IgM HBsAg ELISA Version 1 HBsAg (High Sensitivity 0.1IU) HBsAg (High Sensitivity 0.1IU) Anti-HBs HBeAg Anti-HBe Anti-HBc Anti-HIV Anti-HTLV I&II ELISA 96T 96T 96T 192T 96T 96T 96T 96T 96T 96T E0314 E0315 EC0203 EC0207 E0316 E0317 E0318 E0319 E0321 E1303 Thyroid 96T 96T 96T 96T 96T T3 T4 TSH FT3 FT4 E1001 E1002 E1003 E1004 E1005 Tumor Markers EB04 EB05 EB01 E0203-2 E0205-2 E0106-2 96T 96T 96T 96T 96T 96T EBV EA-IgG EBV VCA-IgA EBV NA1-IgA AFP CEA HCG TORCH 96T 96T 96T 96T 96T 96T 96T 96T 96T 96T Toxo IgM CMV IgM Rubella IgM HSV-1 IgM HSV-2 IgM Toxo IgG CMV IgG Rubella IgG HSV-1 IgG HSV-2 IgG E0901 E0902 E0903 E0904 E0905 E0906 E0907 E0908 E0909 E0910 Autobio Product List Infectious Diseases 04 05 Microbiology Autobio Product List MC0304 Aerobic Culture Bottle SA 20T/Standard Aerobic MC0305 Aerobic Culture Bottle SP 20T/Standard Pediatric MC0306 Anaerobic Culture Bottle SN 20T/Standard Anaerobic MC0401 Mycobacterial Culture Bottle 20T Chlamydia Trachomatis Mycoplasma (UU-MH) Mycoplasma IES Mycoplasma TIES 25T 20T 20T 20T B0102 M0204 M0205 M0206 MA06 Mycoplasma IES Plus 30T M0602 Anaerobic Blood Culture Bottle 20T M0601 Bi-state Blood Culture Bottle 20T MC0301 MC0302 MC0303 Aerobic Culture Bottle FA Anaerobic Culture Bottle FN Aerobic Culture Bottle PF 20T/Resin Aerobic 20T/Resin Anaerobic 20T/Resin Pediatric Amikacin Amoxicillin and clavulanic acid Ampicillin Aztreonam Oxacillin Voriconazole Fluconazole Erythromycin Ciprofloxacin Caspofungin Clindamycin Linezolid Amphotericin B Chloromycetin ME01 ME02 ME03 ME04 ME05 ME06 ME07 ME08 ME09 ME10 ME11 ME12 ME13 ME14 256-0.016 256-0.016 256-0.016 256-0.016 256-0.016 32-0.002 256-0.016 256-0.016 32-0.002 32-0.002 256-0.016 256-0.016 32-0.002 256-0.016 Susceptibility Test Strip ME15 ME16 ME17 ME18 ME19 Meropenem Norfloxacin Penicillin Gentamicin Tetracycline 32-0.002 256-0.016 32-0.002 256-0.016 256-0.016 ME20 Cefuroxime 256-0.016 ME21 ME22 ME23 ME24 ME25 Cefoperazone sulbactam Ceftriaxone Ceftazidine Cefazolin Vancomycin 256-0.016 32-0.002 256-0.016 256-0.016 256-0.016 ME26 Imipenem 32-0.002 ME27 Itraconazole 32-0.002 ME28 Levofloxacin 32-0.002 ME29 Azithromycin 256-0.016 ME30 Ampicillin-Sulbactam 256-0.016 ME31 Polymyxin B 256-0.016 ME32 Trimethoprim-sulfamethoxazole 32-0.002 ME33 Metronidazole 256-0.016 ME34 Rifampicin 32-0.002 ME35 Minocycline 256-0.016 ME36 Piperacillin 256-0.016 ME37 Piperacillin-tazobactam 256-0.016 ME38 Tigecycline 256-0.016 Teicoplanin Cefepime Cefoperazone ME39 ME40 ME41 256-0.016 256-0.016 256-0.016 ME42 Cefotaxime 256-0.016 ME43 ME44 Cefoxitin Ofloxacin 256-0.016 256-0.016 Instruments Autobio Product List Endocrine Control II Endocrine Control II Level 1 Endocrine Control II Level 2 Endocrine Control II Level 3 ZKE0101 ZKE0201 ZKE0301 63.0 mL

Lieven Gevaert Bio-ir.

AutoLumo A2000 PLUS

  1. BC120
  2. Automated Blood Culture System
  3. Autof MS1000 Maldi Tof
  4. LUmo Microplate Luminometer
  5. PHOmo Microplate Reader
  6. iWO Microplate Washer (96-way manifold 8/12 wells per strip)
  7. iWO-960 Microplate Washer (96-way manifold 8/12 wells per strip)
  8. AutoMimo 1200
  9. Automated Sample Preparation System

Automatic Chemiluminescence Immunoassay Analyzer

Panbio Abbott Covid test

Panbio Abbott Covid test

About the Test


Introduction


The Coronavirus disease (COVID-19) is an infectious disease caused
by a newly discovered coronavirus.

Other Microorganism
Staphylococcus aureus 1.0 X 106.0 CFU/ml No cross reaction
2 Staphylococcus saprophyticus 1.0 X 106.0 CFU/ml No cross reaction
3 Neisseria sp.(Neisseria lactamica) 1.0 X 106.0 CFU/ml No cross reaction
4 Escherichia coli 1.0 X 106.0 CFU/ml No cross reaction
5 Staphylococcus haemolyticus 1.0 X 106.0 CFU/ml No cross reaction
6 Streptococcus pyogenes 1.0 X 106.0 CFU/ml No cross reaction
7 Streptococcus salivarius 1.0 X 106.0 CFU/ml No cross reaction
8 Hemophilus parahaemolyticus 1.0 X 106.0 CFU/ml No cross reaction
9 Proteus vulgaris 1.0 X 106.0 CFU/ml No cross reaction
10 Moraxella catarrhalis 1.0 X 106.0 CFU/ml No cross reaction
11 Klebsiella pneumoniae 1.0 X 106.0 CFU/ml No cross reaction
12 Fusobacterium necrophorum 1.0 X 106.0 CFU/ml No cross reaction

Interfering Substances


The following 28 potentially interfering substances have no impact on Panbio™ COVID-19 Ag Rapid Test Device. The final test
concentrations of the interfering substances are documented in the Table below.

Endogenous Substance

  • Mucin 0.5% No Interferenc
  • 2 Hemoglobin 100 mg/L No Interference
  • 3 Triglycerides 1.5 mg/L No Interference
  • 4 Icteric (Bilirubin) 40 mg/dL No Interference
  • 5 Rheumatoid factor 200 IU/ml No Interference
  • 6 Anti-nuclear antibody >1:40 No Interference
  • 7 Pregnant 10-fold dilution No Interference

Exogenous Substance

  • Guaiacol glyceryl ether 1 μg/ml No Interference
  • 9 Albuterol 0.005 mg/dL No Interference
  • 10 Ephedrine 0.1 mg/ml No Interference
  • 11 Chlorpheniramine 0.08 mg/dL No Interference
  • 12 Diphenhydramine 0.08 mg/dL No Interference
  • 13 Ribavirin 26.7 μg /ml No Interference
  • 14 Oseltamivir 0.04 mg/dL No Interference
  • 15 Zanamivir 17.3 μg /ml No Interference
  • 16 Phenylephrine hydrochloride 15% v/v No Interference
  • 17 Oxymetazolin hydrochloride 15% v/v No Interference
  • 18 Amoxicillin 5.4 mg/dL No Interference
  • 19 Acetylsalicylic acid 3 mg/dL No Interference
  • 20 Ibuprofen 21.9 mg/dL No Interference
  • 21 Chlorothiazide 2.7 mg/dL No Interference
  • 22 Indapamide 140 ng/ml No Interference
  • 23 Glimepiride (Sulfonylureas) 0.164 mg/dL No Interference
  • 24 Acarbose 0.03 mg/dL No Interference
  • 25 Ivermectin 4.4 mg/L No Interference
  • 26 Lopinavir 16.4 μg/L No Interference
  • 27 Ritonavir 16.4 μg/L No Interference
  • 28 Chloroquine phosphate 0.99 mg/L No Interference

Repeatability & Reproducibility


Repeatability & Reproducibility of Panbio™ COVID-19 Ag Rapid Test Device was established using in-house reference panels containing
negative specimens and a range of positive specimens. There were no differences observed within-run, between-run, between-lots,
between-sites, and between-days.


  1. Rothan HA, Byrareddy SN. The epidemiology and pathogenesis of coronavirus disease (COVID-19) outbreak. J
    Autoimmun. 2020; Feb 26:102433. doi: 10.1016/j.jaut.2020.102433.
  2. Guo YR, Cao QD, Hong ZS, et al. The origin, transmission and clinical therapies on coronavirus disease 2019 (COVID-19)
    outbreak-an update on the status. Mil Med Res. 2020; Mar 13; 7(1):11.doi:10.1186/s40779-020-00240-0.
  3. Lai CC, Shih TP, Ko WC, et al. Severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2) and coronavirus
    disease-2019 (COVID-19): The epidemic and the challenges. Int J Antimicrob Agents. 2020; Mar 55(3): 105924.doi:

  • Carefully read these instructions prior to using
    Panbio™ COVID-19 Ag Rapid Test Device kit.
  • Lisez attentivement ces instructions avant
    d’utiliser le kit de Panbio™ COVID-19 Ag Rapid
    Test Device.

  • Перед использованием Экспресс-теста
    Panbio™ COVID-19 Ag (Panbio™ COVID-19
    Ag Rapid Test Device) внимательно
    прочитайте данные инструкции.
    Lesen Sie diese Anleitung vor Verwendung des

  • Panbio™ COVID-19 Ag Rapid Test Device
    sorgfältig durch.

  • Leggere attentamente queste istruzioni prima
    di utilizzare il kit Panbio™ COVID-19 Ag Rapid
    Test Device.
    Lea cuidadosamente estas instrucciones de uso
    antes de usar Panbio™ COVID-19 Ag Rapid
    Test Device kit.
    Leia atentamente estas instruções antes de usar
    o kit Panbio™ COVID-19 Ag Rapid Test Device.
    Look at the expiration date of the kit box. If the
    expiration date has passed, use another kit.
    Regardez la date d’expiration de la boîte du kit.
    Si la date d’expiration est dépassée, utilisez un
    autre kit.
    Проверьте срок годности набора. Если
    срок годности прошел, используйте
    другой набор.
    Beachten Sie das Verfallsdatum der KitBox. Wenn das Verfallsdatum abgelaufen ist,
    verwenden Sie einen anderen Kit
    Guarda la data di scadenza della scatola del kit.
    Se la data di scadenza è trascorsa, usa un altro
    kit.
    Revise la fecha de vencimiento de la caja del kit.
    Si la fecha de vencimiento ha pasado, use otro
    kit.
    Observe a data de validade da caixa do kit. Se a
    data de validade já passou, use outro kit.


Open the foil pouch and look for the following:

Result window

Specimen well
Then, label the device with the patient identifier.
Ouvrez la pochette en aluminium et recherchez
les éléments suivants:

Fenêtre de résultats

Échantillon bien
Ensuite, étiquetez l’appareil avec l’identifiant du
patient.
Откройте индивидуальную упаковку тесткассеты и проверьте комплектность:

Окно результата

Ячейка для образца
Затем наклейте на тест-кассету
идентификатор пациента.
Öffnen Sie den Folienbeutel und schauen Sie nach
Folgendem:

Testergebnislesefenster

Probenvertiefung
Beschriften Sie die Testkassette mit der Patient-ID.
Aprire la busta di alluminio e cercare quanto
segue:

Finestra dei risultati

Pozzetto del campione
Quindi, etichettare il dispositivo con l’identificatore
del paziente.
Abra la bolsa de aluminio y revise lo siguiente:

Ventana de resultados

Pocillo de muestra
Luego, rotule el dispositivo con el identificador del
paciente.
Abra a bolsa de alumínio e observe o seguinte:

Janela de resultados

Cavidade de amostra
Em seguida, rotule o dispositivo com o
identificador do paciente.
PREPARATION / VORBEREITUNG / PREPARACIÓN / PREPARATION / PREPARAZIONE
/ PREPARAÇÃO / ПОДГОТОВКА
: 5 drops of the extracted specimen / 5 Tropfen der extrahierten Probe / 5 gotas de la muestra extraída
/ 5 gouttes de l’échantillon extrait / 5 gocce del campione estratto / 5 gotas da amostra extraída
/ 5 капель раствора из экстракционной пробирки
1 2
TEST INTERPRETATION / TEST INTERPRETATION / INTERPRETACIÓN DE LA PRUEBA / INTERPRETATION DU TEST /
INTERPRETAZIONE DEL TEST / INTERPRETAÇÃO DE TESTE / ИНТЕРПРЕТАЦИЯ ТЕСТА
The presence of the test line (T) and the control
line (C) within the result window, regardless
of which line appears first, indicates a positive
result.
Caution: The presence of any test line (T),
no matter how faint, indicates a positive result.
La présence de la ligne de test (T) et de la ligne
de contrôle (C) dans la fenêtre de résultat,
quelle que soit la ligne qui apparaît en premier,
indique un résultat positif.
Attention: la présence d’une ligne de test
(T), aussi faible soit-elle, indique un résultat
positif.
Положительный результат: Наличие
тестовой (T) и контрольной (C) линии в
окне результата, независимо от того, какая
линия появляется первой, указывает на
положительный результат.
Предупреждение: Наличие тестовой
линии (Т), какой бы слабой она ни была,
свидетельствует о положительном
результате.
Erscheinen eine Kontrolllinie (C) und eine Testlinie
(T) innerhalb des Testergebnislesefensters,
unabhängig davon, welche Linie zuerst erscheint,
ist das Ergebnis positiv.
Achtung: Jede Testlinie (T), unabhängig
davon, wie schwach diese Linie ist, ist als positives
Testergebnis zu bewerten.
La presenza della linea di test (T) e della
linea di controllo (C) all’interno della finestra
dei risultati, indipendentemente dalla linea
visualizzata per prima, indica un risultato
positivo.
Attenzione: La presenza di qualsiasi linea di
test (T), non importa quanto debole, indica un
risultato positivo.
La presencia de la línea de prueba (T) y la
línea de control (C) dentro de la ventana de
resultados, independientemente de la línea que
aparezca primero, indica un resultado positivo.
Precaución: La presencia de cualquier
línea de prueba (T), no importa cuán débil sea,
indica un resultado positivo.
A presença da linha de teste (T) e da linha de
controle (C) dentro da janela de resultados,
independentemente de qual linha apareça
primeiro, indica um resultado positivo.
Cuidado: A presença de qualquer linha de
teste (T), não importa o quão tênue, indica um
resultado positivo.
If the control line (C) is not visible within the
result window after performing the test, the
result is considered invalid. Instructions may not
have been followed correctly. It is recommended
to read the IFU again before re-testing the
specimen with a new test device.
Si la ligne de contrôle (C) n’est pas visible dans
la fenêtre de résultat après l’exécution du test,
le résultat est considéré comme invalide. Les
instructions peuvent ne pas avoir été suivies
correctement. Il est recommandé de relire la
notice d’utilisation avant de tester à nouveau
l’échantillon avec un nouveau dispositif de test.
Если контрольная линия (С) не
видна в окне результатов после
выполнения теста, результат считается
неверным. Инструкции могли быть
выполнены неправильно. В этом
случае рекомендуется снова прочитать
инструкцию по применению перед
повторным тестированием образца с
использованием новой тест-кассетой.
Date Issued : 2020.08
41FK10-07-A0
Ist die Kontrolllinie (C) nach der Testdurchführung
innerhalb des Testergebnislesefensters nicht
sichtbar, ist das Ergebnis ungültig.
Die Anweisungen wurden möglicherweise nicht
korrekt befolgt. Es wird empfohlen, die IFU
erneut zu lesen, bevor die Probe mit einer neuen
Testkassette erneut getestet wird.
Se la linea di controllo (C) non è visibile
all’interno della finestra dei risultati dopo
l’esecuzione del test, il risultato viene
considerato non valido. Le istruzioni potrebbero
non essere state seguite correttamente. Si
consiglia di leggere nuovamente il foglietto
illustrativo prima di testare nuovamente il
campione con un nuovo dispositivo di test.
Si la línea de control (C) no está visible dentro
de la ventana de resultados después de realizar
la prueba, el resultado se considera inválido. Es
posible que las instrucciones no se hayan seguido
correctamente. Se recomienda volver a leer las
instrucciones de uso antes de volver a analizar la
muestra con un nuevo dispositivo de prueba.
Se a linha de controle (C) não estiver visível
na janela de resultados após a realização do
teste, o resultado é considerado inválido.
As instruções podem não ter sido seguidas
corretamente. É recomendável ler o a instrução
de uso novamente antes de testar novamente a
amostra com um novo dispositivo de teste.
POSITIVE / POSITIV / POSITIVA / POSITIF / POSITIVO / POSITIVO / ПОЛОЖИТЕЛЬНЫЙ
INVALID / UNGÜLTIG / NO VÁLIDA / INVALIDE / INVALIDO / INVÁLIDO / НЕВЕРНЫЙ РЕЗУЛЬТАТ
6 7 8 9 Open the
dropping nozzle
cap at the bottom
of the extraction
tube.
Abra la tapa de
la boquilla de
goteo en la parte
inferior del tubo
de extracción.
Aprire il tappo
dell’ugello
posizionato nella
parte inferiore
della provetta di
estrazione.
Откройте крышку
колпачка –
капельницы в
нижней части
экстракционной
пробирки.
Öffnen Sie die Kappe
der Dosieröffnung
am Boden des
Extraktionsröhrchens.
Ouvrez le
capuchon de la
buse à goutte
au bas du tube
d’extraction.
Abra a tampa
do bico de
gotejamento na
parte inferior do
tubo de extração.
Start timer. Read
result at 15 minutes.
Do not read results
after 20 minutes.
De inicio al
temporizador. Leer
resultado a los 15
minutos. No lea los
resultados después
de 20 minutos.
Avviare il timer.
Leggere il risultato
a 15 minuti. Non
leggere i risultati
dopo 20 minuti.
Запустите таймер.
Результат можно
считывать через 15
минут. Не считывайте
результаты, если прошло
20 минут и больше.
Starten Sie die Uhr
und lesen Sie das
Ergebnis nach 15
Minuten ab. Lesen
Sie das Ergebnis
nicht mehr nach 20
Minuten ab.
Démarrer le
minuteur, lire le
résultat à 15 minutes.
Ne pas lire le résultat
après 20 minutes.
Inicie o cronômetro.
Leia o resultado
do teste em 15
minutos. Não leia os
resultados após 20
minutos.
Dispense 5 drops of extracted specimens vertically into the
specimen well (S) on the device. Do not handle or move the
test device until the test is complete and ready for reading.
Caution: Bubbles that occur in the extraction tube
can lead to inaccurate results. If you are unable to create
sufficient drops, this may be caused by clogging in the
dispensing nozzle. Shake the tube gently to release the
blockage until you observe free drop formation.
Dispense 5 gotas de las muestras extraídas verticalmente en
el pocillo de la muestra (S) en el dispositivo. No manipule
ni mueva el dispositivo de prueba hasta que la prueba esté
completa y lista para leer.
Precaución: Las burbujas que se forman en el tubo
de extracción pueden dar lugar a resultados incorrectos.
Si no puede crear suficientes gotas, esto puede deberse a
una obstrucción en la boquilla dispensadora. Agite el tubo
suavemente para liberar el bloqueo hasta que observe la
formación de gotas libres.
Dispensare 5 gocce di campione estratto verticalmente
nel pozzetto del test (S) sul dispositivo. Non maneggiare o
spostare il dispositivo fino a quando il test non è completo e
pronto per la lettura.
Attenzione: La comparsa di bolle nella provetta di
estrazione può portare a risultati imprecisi. Se non si riuscisse
ad ottenere un numero di gocce sufficienti, ciò potrebbe
essere causato dall’intasamento dell’ugello di erogazione.
Agitare delicatamente la provetta per rimuovere l’ostruzione
fino a osservare la formazione di goccia libera.
Внесите 5 капель раствора из экстракционной
пробирки вертикально в ячейку для образца (S) на
тест-кассете. Не трогайте и не перемещайте тесткассету, пока тест не будет завершен и готов к
считыванию.
Предупреждение: Пузырьки, возникающие
в экстракционной пробирке, могут привести к
неточным результатам. Если отмерить достаточное
количество капель не удается, это может быть
вызвано засорением колпачка-капельницы.
Осторожно встряхните пробирку, чтобы устранить
обструкцию, пока не образуются свободные капли.
Geben Sie 5 Tropfen der extrahierten Proben senkrecht
in die Probenvertiefung (S) der Testkassette. Bewegen Sie
die Testkassette nicht, bis der Test abgeschlossen und zum
Ablesen bereit ist.
Achtung: Blasen, die im Extraktionsröhrchen auftreten,
können zu ungenauen Ergebnissen führen. Wenn Sie nicht
in der Lage sind, genügend Tropfen zu erzeugen, kann dies
an einer Verstopfung der Dosieröffnung liegen. Schütteln
Sie das Röhrchen leicht, um die Verstopfung zu lösen, bis Sie
eine freie Tropfenbildung beobachten können.
Distribuer verticalement 5 gouttes d’échantillons extraits
dans le puits d’échantillon (S) de l’appareil. Ne pas manipuler
ni déplacer le dispositif de test tant que le test n’est pas
terminé et prêt pour la lecture.
Attention: les bulles qui se produisent dans le tube
d’extraction peuvent conduire à des résultats inexacts. Si
vous ne parvenez pas à créer suffisamment de gouttes,
cela peut être dû à un colmatage de la buse de distribution.
Secouez doucement le tube pour libérer le blocage jusqu’à ce
que vous observiez la formation de gouttes libres.
Dispense 5 gotas das amostras extraídas verticalmente na
cavidade da amostra (S) do dispositivo. Não manuseie ou
mova o dispositivo de teste até que o teste esteja concluído e
pronto para leitura.
Cuidado: As bolhas que ocorrem no tubo de
extração podem levar a resultados imprecisos. Se você não
conseguir criar gotas suficientes, isso pode ser causado por
entupimento no bico dispensador. Agite o tubo suavemente
para liberar o bloqueio até observar a formação livre de gotas.
TEST PROCEDURE / TESTVERFAHREN / PROCEDIMIENTO DE LA PRUEBA / PROCEDURE / PROCEDURA DEL TEST / PROCEDIMENTO DE TESTE / ПРОЦЕДУРА ТЕСТИРОВАНИЯ
5 x
Close the nozzle
and dispose of the
extraction tube
containing the used
swab according to your
local regulations and
biohazard waste disposal
protocol.
Cierre la boquilla y
deseche el tubo de
extracción que contiene el
hisopo usado de acuerdo
con las regulaciones
locales y el protocolo de
eliminación de desechos
de riesgo biológico.
Chiudere l’ugello e
smaltire la provetta di
estrazione contenente
il tampone usato in
base alle normative
locali e al protocollo di
smaltimento dei rifiuti
biologici.
Закройте колпачоккапельницу, и утилизируйте
экстракционную
пробирку, содержащую
использованный тампон в
соответствии с местными
правилами и протоколом
утилизации биологически
опасных отходов.
Schließen Sie die
Dosieröffnung und entsorgen
Sie das Extraktionsröhrchen
mit dem gebrauchten
Tupfer gemäß den örtlichen
Vorschriften und dem
Entsorgungsprotokoll für
biologisch gefährliche Abfälle.
Fermez la buse et jetez
le tube d’extraction
avec l’écouvillon usagé
conformément à
vos réglementations
locales et au protocole
d’élimination des déchets
biologiques.
Feche o bico e descarte
o tubo de extração
contendo o swab usado
de acordo com os
regulamentos locais e o
protocolo de descarte
de resíduos de risco
biológico.

2 Open the package and look for the following:

  • Test device with desiccant in individual
    foil pouch
  • Buffer
  • Extraction tube
  • Extraction tube cap
  • Positive control swab
  • Negative control swab
  • Sterilized nasopharyngeal swabs for
    sample collection
  • Tube rack
  • Quick reference guide (Nasopharyngeal)
  • Instructions for use
    Ouvrez la boite et recherchez les éléments
    suivants
  • Testeur avec déshydratant dans un sachet
    individuel en aluminium
  • Solution tampon
  • Tube d’extraction
  • Bouchon pour les tubes d’extraction
  • Écouvillon de contrôle positif
  • Écouvillon de contrôle négatif
  • Écouvillons nasopharyngés stérilisés pour
    le prélèvement d’échantillons
  • Porte tubes
  • Guide de référence rapide
    (nasopharyngé)
  • Notice d’utilisation
    Откройте упаковку и проверьте комплектность:
  • Тест-кассета в индивидуальной вакуумной упаковке с
    осушителем
  • Буфер
  • Пробирка экстракционная
  • Колпачок для пробирки экстракционной
  • Положительный контрольный образец
  • Отрицательный контрольный образец
  • Стерильные назофарингеальные тампоны (тупферов) для
    сбора образцов
  • Штатив
  • Краткое руководство (назофарингеальный тампон)
  • Инструкция по применению
    Öffnen Sie die Verpackung und Entnehmen
    Sie Folgendes:
  • Testkassetten verpackt in Folienbeutel
    mit Trockenmittel
  • Puffer
  • Extraktionsröhrchen
  • Deckel für Extraktionsröhrchen
  • Positivkontrolltupfer
  • Negativkontrolltupfer
  • Sterilisierte nasopharyngeale Tupfer zur
    Probenahme
  • Ständer für Röhrchen
  • Kurzanleitung (Nasopharyngeal)
  • Gebrauchsanweisung
    Aprire la confezione e cercare quanto segue:
  • Dispositivo di test confezionato
    singolarmente in busta di alluminio con
    essiccante
  • Buffer
  • Provetta di estrazione
  • Tappo della provetta di estrazione
  • Tampone di controllo positivo
  • Tampone di controllo negativo
  • Tamponi sterili nasofaringei per la
    raccolta del campione
  • Rack portaprovette
  • Guida rapida di riferimento
    (Nasofaringeo)
  • Istruzioni per l’uso
    Abra el paquete y revise los siguientes
    componentes:
  • Dispositivo de prueba con desecante en
    bolsa de aluminio individual
  • Solución tampón
  • Tubo de extracción
  • Tapa de tubos de extracción
  • Hisopo control positivo
  • Hisopo control negativo
  • Hisopos nasofaríngeos esterilizados para
    la recolección de muestras
  • Gradilla para tubos
  • Guía de referencia rápida (nasofaríngea)
  • Instrucciones de uso
    Abra o pacote e observe o seguinte:
  • Dispositivo de teste com dessecante em
    bolsa individual
  • Tampão
  • Tubo de extração
  • Tampa de tubos de extração
  • Swab controle positivo
  • Swab controle negativo
  • Swabs nasofaríngeos esterilizados para
    coleta de amostra
  • Suporte para tubos

Guia de referência rápida (nasofaríngea)

I
device according to
your local regulations
and biohazard waste
disposal protocol.
Deseche el dispositivo
usado de acuerdo
con las regulaciones
locales y el protocolo
de eliminación de
desechos de riesgo
biológico.
Smaltire il dispositivo
usato in base alle
normative locali
e al protocollo di
smaltimento dei rifiuti
biologici.
Использованную тесткассету утилизируют
в соответствии с
местными правилами и
протоколом утилизации
биологически опасных
отходов.
Entsorgen Sie
die gebrauchte
Testkassette gemäß
den örtlichen
Vorschriften und dem
Entsorgungsprotokoll
für biologisch
gefährlichen Abfall.
L’Elimination des
appareils usagés se fait
conformément à la
réglementation locale
en vigueur et selon le
protocole d’élimination
des déchets dangereux.
Descarte o dispositivo
usado de acordo com
os regulamentos
locais e o protocolo de
descarte de resíduos de
risco biológico.
EN
PT
RU
FR
DE
ES
IT
Nr. Art der Probe Kreuzreaktionssubstanz Finale Testkonzentration Testergebnis
1
Andere
Mikroorganismen
Staphylococcus aureus 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
2 Staphylococcus saprophyticus 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
3 Neisseria sp,(Neisseria lactamica) 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
4 Escherichia coli 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
5 Staphylococcus haemolyticus 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
6 Streptococcus pyogenes 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
7 Streptococcus salivarius 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
8 Hemophilus parahaemolyticus 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
9 Proteus vulgaris 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
10 Moraxella catarrhalis 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
11 Klebsiella pneumoniae 1,0 X 106,0 CFU/ml Keine Kreuzreaktion
12 Fusobacterium necrophorum 1,0 X 106,0 CFU/ml Keine Kreuzreaktion

  • Keine Konzentrationsangabe durch den Lieferanten. Unverdünnte Stammlösung wurde getestet.
  1. Interferierende Substanzen
    Die folgenden 28 potenziell interferierenden Substanzen haben keinen Einfluss auf Panbio™ COVID-19 Ag Rapid Test Device. Die
    endgültigen Testkonzentrationen der Störsubstanzen sind in der folgenden Tabelle dokumentiert.
    Nr. Art der Probe Interferierende Substanzen Finale Testkonzentration Testergebnis
    1
    Endogene Substanz
    Mucin 0,5% Keine Interferenz
    2 Hämoglobin 100 mg/L Keine Interferenz
    3 Triglyceride 1,5 mg/L Keine Interferenz
    4 Icteric (Bilirubin) 40 mg/dL Keine Interferenz
    5 Rheuma-Faktor 200 IU/ml Keine Interferenz
    6 Anti-nuklearer Antikörper >1:40 Keine Interferenz
    7 Schwanger 10-fach verdünnt Keine Interferenz
    8
    Exogene Substanz
    Guajakol-Glyceryl-Ether 1 μg/ml Keine Interferenz
    9 Albuterol 0,005 mg/dL Keine Interferenz
    10 Ephedrin 0,1 mg/ml Keine Interferenz
    11 Chlorpheniramin 0,08 mg/dL Keine Interferenz
    12 Diphenhydramin 0,08 mg/dL Keine Interferenz
    13 Ribavirin 26,7 μg /ml Keine Interferenz
    14 Oseltamivir 0,04 mg/dL Keine Interferenz
    15 Zanamivir 17,3 μg /ml Keine Interferenz
    16 Phenylephrin-Hydrochlorid 15% v/v Keine Interferenz
    17 Oxymetazolin-Hydrochlorid 15% v/v Keine Interferenz
    18 Amoxicillin 5,4 mg/dL Keine Interferenz
    19 Acetylsalicylsäure 3 mg/dL Keine Interferenz
    20 Ibuprofen 21,9 mg/dL Keine Interferenz
    21 Chlorothiazid 2,7 mg/dL Keine Interferenz
    22 Indapamid 140 ng/ml Keine Interferenz
    23 Glimepirid (Sulfonylharnstoffe) 0,164 mg/dL Keine Interferenz
    24 Acarbose 0,03 mg/dL Keine Interferenz
    25 Ivermectin 4,4 mg/L Keine Interferenz
    26 Lopinavir 16,4 μg/L Keine Interferenz
    27 Ritonavir 16,4 μg/L Keine Interferenz
    28 Chloroquinphosphat 0,99 mg/L Keine Interferenz
  2. Wiederholbarkeit & Reproduzierbarkeit
    Die Wiederholbarkeit und Reproduzierbarkeit von Panbio™ COVID-19 Ag Rapid Test Device wurde unter Verwendung eines internen
    Referenzpanels mit negativen Proben und einer Reihe positiver Proben festgestellt. Es wurden keine Unterschiede innerhalb der Testreihe,
    zwischen den Testreihen, zwischen den Chargen, zwischen den Standorten und zwischen den Tagen festgestellt.
    No, Types d’ échantillons Substance de réaction croisée Concentration finale du test Résultat du Test
    1
    Autre
    Microorganisme
    Staphylococcus aureus 1,0 X 106,0 CFU/ml Pas de réaction croisée
    2 Staphylococcus saprophyticus 1,0 X 106,0 CFU/ml Pas de réaction croisée
    3 Neisseria sp.(Neisseria lactamica) 1,0 X 106,0 CFU/ml Pas de réaction croisée
    4 Escherichia coli 1,0 X 106,0 CFU/ml Pas de réaction croisée
    5 Staphylococcus haemolyticus 1,0 X 106,0 CFU/ml Pas de réaction croisée
    6 Streptococcus pyogenes 1,0 X 106,0 CFU/ml Pas de réaction croisée
    7 Streptococcus salivarius 1,0 X 106,0 CFU/ml Pas de réaction croisée
    8 Hemophilus parahaemolyticus 1,0 X 106,0 CFU/ml Pas de réaction croisée
    9 Proteus vulgaris 1,0 X 106,0 CFU/ml Pas de réaction croisée
    10 Moraxella catarrhalis 1,0 X 106,0 CFU/ml Pas de réaction croisée
    11 Klebsiella pneumoniae 1,0 X 106,0 CFU/ml Pas de réaction croisée
    12 Fusobacterium necrophorum 1,0 X 106,0 CFU/ml Pas de réaction croisée
  • Aucune concentration fournie par le fournisseur. La solution mère non diluée a été testée.
  1. Substances interférentes
    Les 28 substances potentiellement interférentes suivantes n’ont aucun impact sur le Panbio™ COVID-19 Ag Rapid Test Device. Les
    concentrations d’essai finales des substances interférentes sont documentées dans le tableau ci-dessous.
    No, Types d’ échantillons Substances interférentes Concentration finale du test Résultat du Test
    1
    Substance Endogène
    Mucine 0,5% Pas d’interférence
    2 Hémoglobine 100 mg/L Pas d’interférence
    3 Triglycérides 1,5 mg/L Pas d’interférence
    4 Ictère (Bilirubine) 40 mg/dL Pas d’interférence
    5 Facteur Rhumatoïde 200 IU/ml Pas d’interférence
    6 Anticorps anti-nucléaire >1:40 Pas d’interférence
    7 Enceinte Dilution au dixième Pas d’interférence
    8
    Substance Exogène
    Éther glycérylique de guaiacol 1 μg/ml Pas d’interférence
    9 Albuterol 0,005 mg/dL Pas d’interférence
    10 Ephedrine 0,1 mg/ml Pas d’interférence
    11 Chlorpheniramine 0,08 mg/dL Pas d’interférence
    12 Diphenhydramine 0,08 mg/dL Pas d’interférence
    13 Ribavirin 26,7 μg /ml Pas d’interférence
    14 Oseltamivir 0,04 mg/dL Pas d’interférence
    15 Zanamivir 17,3 μg /ml Pas d’interférence
    16 Chlorhydrate de phényléphrine 15% v/v Pas d’interférence
    17 Chlorhydrate d’oxymétazoline 15% v/v Pas d’interférence
    18 Amoxicilline 5,4 mg/dL Pas d’interférence
    19 Acide acétylsalicylique 3 mg/dL Pas d’interférence
    20 Ibuprofène 21,9 mg/dL Pas d’interférence
    21 Chlorothiazide 2,7 mg/dL Pas d’interférence
    22 Indapamide 140 ng/ml Pas d’interférence
    23 Glimépiride (sulfonylurées) 0,164 mg/dL Pas d’interférence
    24 Acarbose 0,03 mg/dL Pas d’interférence
    25 Ivermectine 4,4 mg/L Pas d’interférence
    26 Lopinavir 16,4 μg/L Pas d’interférence
    27 Ritonavir 16,4 μg/L Pas d’interférence
    28 Phosphate de chloroquine 0,99 mg/L Pas d’interférence
  2. Répétabilité et reproductibilité
    La répétabilité et la reproductibilité du Panbio™ COVID-19 Ag Rapid Test Device ont été établies à l’aide de panels de référence internes
    contenant des échantillons négatifs et une gamme d’échantillons positifs.. Aucune différence n’a été observée à l’intérieur des séries, entre les
    séries, entre les lots, entre les sites et entre les jours.
    Nº Tipos de Espécime Substância de Reação Cruzada Concentração de Teste Final Resultado do Teste
    1
    Outro Microrganismo
    Staphylococcus aureus 1,0 X 106,0 CFU/ml Sem reação cruzada
    2 Staphylococcus saprophyticus 1,0 X 106,0 CFU/ml Sem reação cruzada
    3 Neisseria sp,(Neisseria lactamica) 1,0 X 106,0 CFU/ml Sem reação cruzada
    4 Escherichia coli 1,0 X 106,0 CFU/ml Sem reação cruzada
    5 Staphylococcus haemolyticus 1,0 X 106,0 CFU/ml Sem reação cruzada
    6 Streptococcus pyogenes 1,0 X 106,0 CFU/ml Sem reação cruzada
    7 Streptococcus salivarius 1,0 X 106,0 CFU/ml Sem reação cruzada
    8 Hemophilus parahaemolyticus 1,0 X 106,0 CFU/ml Sem reação cruzada
    9 Proteus vulgaris 1,0 X 106,0 CFU/ml Sem reação cruzada
    10 Moraxella catarrhalis 1,0 X 106,0 CFU/ml Sem reação cruzada
    11 Klebsiella pneumoniae 1,0 X 106,0 CFU/ml Sem reação cruzada
    12 Fusobacterium necrophorum 1,0 X 106,0 CFU/ml Sem reação cruzada
    *Nenhuma concentração fornecida pelo fornecedor. A solução estoque não diluída foi testada.
  3. Substâncias Interferentes
    As seguintes 28 substâncias potencialmente interferentes não têm impacto no Panbio™ COVID-19 Ag Rapid Test Device. As
    concentrações de teste finais das substâncias interferentes estão documentadas na Tabela abaixo.
    Nº Tipos de Espécime Substâncias Interferentes Concentração de Teste Final Resultado do Teste
    1
    Substância Endógena
    Mucina 0,5% Sem Interferências
    2 Hemoglobina 100 mg/L Sem Interferências
    3 Triglicerídeos 1,5 mg/L Sem Interferências
    4 Icterícia (bilirrubina) 40 mg/dL Sem Interferências
    5 Fatores reumatoides 200 IU/ml Sem Interferências
    6 Anticorpo antinuclear >1:40 Sem Interferências
    7 Grávida Diluição de 10 vezes Sem Interferências
    8
    Substância Exógena
    Guaiacol gliceril éter 1 μg/ml Sem Interferências
    9 Albuterol 0,005 mg/dL Sem Interferências
    10 Efedrina 0,1 mg/ml Sem Interferências
    11 Clorfeniramina 0,08 mg/dL Sem Interferências
    12 Difenidramina 0,08 mg/dL Sem Interferências
    13 Ribavirina 26,7 μg /ml Sem Interferências
    14 Oseltamivir 0,04 mg/dL Sem Interferências
    15 Zanamivir 17,3 μg /ml Sem Interferências
    16 Cloridrato de fenilefrina 15% v/v Sem Interferências
    17 Cloridrato de oximetazolina 15% v/v Sem Interferências
    18 Amoxicilina 5,4 mg/dL Sem Interferências
    19 Ácido acetilsalicílico 3 mg/dL Sem Interferências
    20 Ibuprofeno 21,9 mg/dL Sem Interferências
    21 Clorotiazida 2,7 mg/dL Sem Interferências
    22 Indapamida 140 ng/ml Sem Interferências
    23 Glimepirida (Sulfonilureias) 0,164 mg/dL Sem Interferências
    24 Acarbose 0,03 mg/dL Sem Interferências
    25 Ivermectina 4,4 mg/L Sem Interferências
    26 Lopinavir 16,4 μg/L Sem Interferências
    27 Ritonavir 16,4 μg/L Sem Interferências
    28 Fosfato de cloroquina 0,99 mg/L Sem Interferências
  4. Repetibilidade e Reprodutibilidade
    Repetibilidade e reprodutibilidade do Panbio™ COVID-19 Ag Rapid Test Device foram estabelecidas usando painéis de referência
    internos contendo amostras negativas e uma gama de amostras positivas. Não houve diferenças observadas dentro da execução, entre
    execuções, entre lotes, entre locais e entre dias.
    No, Tipo de muestra Sustancia de reacción cruzada Concentración de prueba final Resultado de la prueba
    1
    Otros
    Microorganismos
    Staphylococcus aureus 1,0 X 106,0 CFU/mL Sin reacción cruzada
    2 Staphylococcus saprophyticus 1,0 X 106,0 CFU/mL Sin reacción cruzada
    3 Neisseria sp,(Neisseria lactamica) 1,0 X 106,0 CFU/mL Sin reacción cruzada
    4 Escherichia coli 1,0 X 106,0 CFU/mL Sin reacción cruzada
    5 Staphylococcus haemolyticus 1,0 X 106,0 CFU/mL Sin reacción cruzada
    6 Streptococcus pyogenes 1,0 X 106,0 CFU/mL Sin reacción cruzada
    7 Streptococcus salivarius 1,0 X 106,0 CFU/mL Sin reacción cruzada
    8 Hemophilus parahaemolyticus 1,0 X 106,0 CFU/mL Sin reacción cruzada
    9 Proteus vulgaris 1,0 X 106,0 CFU/mL Sin reacción cruzada
    10 Moraxella catarrhalis 1,0 X 106,0 CFU/mL Sin reacción cruzada
    11 Klebsiella pneumoniae 1,0 X 106,0 CFU/mL Sin reacción cruzada
    12 Fusobacterium necrophorum 1,0 X 106,0 CFU/mL Sin reacción cruzada
  • Sin concentración proporcionada por el proveedor. Se evaluó la solución madre sin diluir.
  1. Sustancias interferentes
    Las siguientes 28 sustancias potencialmente interferentes no tienen ningún impacto en Panbio™ COVID-19 Ag Rapid Test Device.
    Las concentraciones de prueba finales de las sustancias interferentes se documentan en la siguiente tabla.
    No, Tipo de muestra Sustancias Interferentes Concentración de prueba final Resultado de la prueba
    1
    Sustancia Endógena
    Mucina 0,5% Sin interferencia
    2 Hemoglobina 100 mg/L Sin interferencia
    3 Triglicéridos 1,5 mg/L Sin interferencia
    4 Icterico (Bilirrubina) 40 mg/dL Sin interferencia
    5 Factor reumatoide 200 IU/mL Sin interferencia
    6 Anticuerpo antinuclear >1:40 Sin interferencia
    7 Embarazo Dilución de 10 veces Sin interferencia
    8
    Sustancia Exógena
    Éter de glicerilo guayacol 1 μg/mL Sin interferencia
    9 Albuterol 0,005 mg/dL Sin interferencia
    10 Efedrina 0,1 mg/mL Sin interferencia
    11 Clorfeniramina 0,08 mg/dL Sin interferencia
    12 Difenhidramina 0,08 mg/dL Sin interferencia
    13 Ribavirina 26,7 μg /mL Sin interferencia
    14 Oseltamivir 0,04 mg/dL Sin interferencia
    15 Zanamivir 17,3 μg /mL Sin interferencia
    16 Clorhidrato de fenilefrina 15% v/v Sin interferencia
    17 Clorhidrato de oximetazolina 15% v/v Sin interferencia
    18 Amoxicilina 5,4 mg/dL Sin interferencia
    19 Ácido acetilsalicílico 3 mg/dL Sin interferencia
    20 Ibuprofeno 21,9 mg/dL Sin interferencia
    21 Clorotiazida 2,7 mg/dL Sin interferencia
    22 Indapamida 140 ng/mL Sin interferencia
    23 Glimepirida (sulfonilureas) 0,164 mg/dL Sin interferencia
    24 Acarbose 0,03 mg/dL Sin interferencia
    25 Ivermectina 4,4 mg/L Sin interferencia
    26 Lopinavir 16,4 μg/L Sin interferencia
    27 Ritonavir 16,4 μg/L Sin interferencia
    28 Fosfato de cloroquina 0,99 mg/L Sin interferencia
  2. Repetibilidad y reproducibilidad
    La repetibilidad y reproducibilidad de Panbio™ COVID-19 Ag Rapid Test Device se estableció utilizando paneles de referencia
    internos que contienen muestras negativas y una variedad de muestras positivas. No se observaron diferencias dentro de las
    evaluaciones, entre evaluaciones, entre lotes, entre sitios y entre días.
    No, Tipi di campione Elemento di cross-reazione Concentrazione finale di test Risultato del test
    1
    Altro Microorganismo
    Staphylococcus aureus 1,0 X 106,0 CFU/ml Nessuna cross reazione
    2 Staphylococcus saprophyticus 1,0 X 106,0 CFU/ml Nessuna cross reazione
    3 Neisseria sp,(Neisseria lactamica) 1,0 X 106,0 CFU/ml Nessuna cross reazione
    4 Escherichia coli 1,0 X 106,0 CFU/ml Nessuna cross reazione
    5 Staphylococcus haemolyticus 1,0 X 106,0 CFU/ml Nessuna cross reazione
    6 Streptococcus pyogenes 1,0 X 106,0 CFU/ml Nessuna cross reazione
    7 Streptococcus salivarius 1,0 X 106,0 CFU/ml Nessuna cross reazione
    8 Hemophilus parahaemolyticus 1,0 X 106,0 CFU/ml Nessuna cross reazione
    9 Proteus vulgaris 1,0 X 106,0 CFU/ml Nessuna cross reazione
    10 Moraxella catarrhalis 1,0 X 106,0 CFU/ml Nessuna cross reazione
    11 Klebsiella pneumoniae 1,0 X 106,0 CFU/ml Nessuna cross reazione
    12 Fusobacterium necrophorum 1,0 X 106,0 CFU/ml Nessuna cross reazione
  • Nessuna concentrazione fornita dal fornitore. È stata testata una soluzione di stock non diluito.
  1. Sostanze interferenti
    Le seguenti 28 sostanze potenzialmente interferenti non hanno alcun impatto su Panbio™ COVID-19 Ag Rapid Test Device. La
    concentrazione finale di test delle sostanze interferenti è documentata nella tabella sotto.
    No, Tipi di campione Sostanze interferenti Concentrazione finale di test Risultato del test
    1
    Sostanza endogena
    Mucin 0,5% Nessuna interferenza
    2 Hemoglobin 100 mg/L Nessuna interferenza
    3 Triglycerides 1,5 mg/L Nessuna interferenza
    4 Icteric (Bilirubin) 40 mg/dL Nessuna interferenza
    5 Rheumatoid factor 200 IU/ml Nessuna interferenza
    6 Anti-nuclear antibody >1:40 Nessuna interferenza
    7 Pregnant Diluizione 1:10 Nessuna interferenza
    8
    Sostanza esogena
    Guaiacol glyceryl ether 1 μg/ml Nessuna interferenza
    9 Albuterol 0,005 mg/dL Nessuna interferenza
    10 Ephedrine 0,1 mg/ml Nessuna interferenza
    11 Chlorpheniramine 0,08 mg/dL Nessuna interferenza
    12 Diphenhydramine 0,08 mg/dL Nessuna interferenza
    13 Ribavirin 26,7 μg /ml Nessuna interferenza
    14 Oseltamivir 0,04 mg/dL Nessuna interferenza
    15 Zanamivir 17,3 μg /ml Nessuna interferenza
    16 Phenylephrine hydrochloride 15% v/v Nessuna interferenza
    17 Oxymetazolin hydrochloride 15% v/v Nessuna interferenza
    18 Amoxicillin 5,4 mg/dL Nessuna interferenza
    19 Acetylsalicylic acid 3 mg/dL Nessuna interferenza
    20 Ibuprofen 21,9 mg/dL Nessuna interferenza
    21 Chlorothiazide 2,7 mg/dL Nessuna interferenza
    22 Indapamide 140 ng/ml Nessuna interferenza
    23 Glimepiride (Sulfonylureas) 0,164 mg/dL Nessuna interferenza
    24 Acarbose 0,03 mg/dL Nessuna interferenza
    25 Ivermectin 4,4 mg/L Nessuna interferenza
    26 Lopinavir 16,4 μg/L Nessuna interferenza
    27 Ritonavir 16,4 μg/L Nessuna interferenza
    28 Chloroquine phosphate 0,99 mg/L Nessuna interferenza
  2. Ripetibilità e riproducibilità
    La ripetibilità e la riproducibilità di Panbio™ COVID-19 Ag Rapid Test Device sono state stabilite utilizzando pannelli di riferimento
    interni contenenti campioni positivi alti, positivi medi, positivi deboli e negativi. Non sono state osservate differenze all’interno della
    serie, tra le serie, tra i lotti, tra i siti e tra i giorni.
    № Типы образцов Вещество, вызывающее перекрестную реакцию Окончательная тестовая
    концентрация Результаты теста
    1
    Другой
    микроорганизм
    Staphylococcus aureus 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    2 Staphylococcus saprophyticus 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    3 Neisseria sp.(Neisseria lactamica) 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    4 Escherichia coli 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    5 Staphylococcus haemolyticus 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    6 Streptococcus pyogenes 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    7 Streptococcus salivarius 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    8 Hemophilus parahaemolyticus 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    9 Proteus vulgaris 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    10 Moraxella catarrhalis 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    11 Klebsiella pneumoniae 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    12 Fusobacterium necrophorum 1,0 X 106.0 КОЕ/мл Нет перекрестной реакции
    *Поставщик не предоставил концентрации. Был протестирован неразбавленный исходный раствор.
  3. Интерферирующие вещества
    Следующие 28 потенциально интерферирующих веществ не оказывают никакого влияния на Экспресс-тест Panbio™
    COVID-19 Ag (Panbio™ COVID-19 Ag Rapid Test Device). Окончательные тестовые концентрации интерферирующих веществ
    задокументированы в нижеприведенной таблице.
    № Типы образцов Интерферирующие вещества Окончательная тестовая концентрация Результаты теста
    1
    Эндогенная субстанция
    Муцин 0,5% Нет влияния
    2 Гемоглобин 100 мг/л Нет влияния
    3 Триглицериды 1,5 мг/л Нет влияния
    4 Билирубин 40 мг/дл Нет влияния
    5 Ревматоидный фактор 200 МЕ/мл Нет влияния
    6 Антиядерное антитело >1:40 Нет влияния
    7 Беременность 10-кратное разведение Нет влияния
    8
    Экзогенная субстанция
    Глицериловый эфир гваяколя 1 мкг/мл Нет влияния
    9 Альбутерол 0,005 мг/дл Нет влияния
    10 Эфедрин 0,1 мг/мл Нет влияния
    11 Хлорфенирамин 0,08 мг/дл Нет влияния
    12 Дифенгидрамин 0,08 мг/дл Нет влияния
    13 Рибавирин 26,7 мкг/мл Нет влияния
    14 Осельтамивир 0,04 мг/дл Нет влияния
    15 Занамивир 17,3 мкг/мл Нет влияния
    16 Фенилэфрина гидрохлорид 15% об./об. Нет влияния
    17 Оксиметазолина гидрохлорид 15% об./об. Нет влияния
    18 Амоксициллин 5,4 мг/дл Нет влияния
    19 Ацетилсалициловая кислота 3 мг/дл Нет влияния
    20 Ибупрофен 21,9 мг/дл Нет влияния
    21 Хлортиазид 2,7 мг/дл Нет влияния
    22 Индапамид 140 нг/мл Нет влияния
    23 Глимепирид (Сульфонилмочевина) 0,164 мг/дл Нет влияния
    24 Акарбоза 0,03 мг/дл Нет влияния
    25 Ивермектин 4,4 мг/л Нет влияния
    26 Лопинавир 16,4 мкг/л Нет влияния
    27 Ритонавир 16,4 мкг/л Нет влияния
    28 Хлорохина фосфат 0,99 мг/л Нет влияния
  4. Повторяемость и воспроизводимость
    Повторяемость и воспроизводимость Экспресс-тест Panbio™ COVID-19 Ag (Panbio™ COVID-19 Ag Rapid Test Device) была
    определена с использованием собственных эталонных панелей, содержащих отрицательные образцы и ряд положительных
    образцов. Различий в внутри одной серии, между сериями, между центрами и между днями не наблюдали.

    The presence of only the control line (C) and no
    test line (T) within the result window indicates a
    negative result.
    La présence seule de la ligne de contrôle (C)
    et aucune ligne de test (T) dans la fenêtre de
    résultat indique un résultat négatif.
    Наличие только контрольной линии
    (С) и отсутствие тестовой линии (Т) в
    окошке для считывания указывает на
    отрицательный результат теста.
    Erscheinen eine Kontrolllinie (C)
    und keine Testlinie (T) innerhalb des
    Testergebnislesefensters, ist das Ergebnis negativ.
    La presenza della sola linea di controllo (C) e
    nessuna linea di test (T) all’interno della finestra
    dei risultati indica un risultato negativo.
    La presencia de solo la línea de control (C) y
    ninguna línea de prueba (T) dentro de la ventana
    de resultados indica un resultado negativo.
    A presença apenas da linha de controle (C) e
    nenhuma linha de teste (T) dentro da janela de
    resultado indica um resultado negativo.
  5. In Vitro Diagnostic Assays for COVID-19: Recent Advances and Emerging Trends (Sandeep Kumar Vashist, 2020 April
    05: diagnostics)
  6. Nano Research for COVID-19 (http://dx.doi.org/10.1021/acsnano.0c02540)
  7. Coronavirus (COVID-19) Update: FDA Authorizes First Antigen Test to Help in the Rapid Detection of the Virus that
    Causes COVID-19 in Patients (Stephen M, Hahn M.D. 2020 May 09: Commisioner of Food and Drugs
  8. Current Intelligence Bulletin 13: Explosive Azide Hazard DHHS (NIOSH) Publication Number 78-127 August 16, 1976
  9. CDC. Discontinuation of Transmission-Based Precautions and Disposition of Patients with COVID-19 in Healthcare
    Settings (Interim Guidance). (2020).
  10. CDC. Duration of Isolation and Precautions for Adults with COVID-19. (2020).
    TECHNICAL SUPPORT / TECHNISCHER SUPPORT / SOPORTE TÉCNICO / SUPPORT TECHNIQUE / SUPPORTO TECNICO / SUPORTE TÉCNICO
    / ОТДЕЛ ТЕХНИЧЕСКОЙ ПОДДЕРЖКИ
    Europe & Middle East / Europa & Mittlerer Osten / Europa y Medio Oriente / Europe & Moyen Orient
    / Europe & Middle East / Europa e Oriente Médio / Европа, Ближний Восток
    +44 161 483 9032 | EMEproductsupport@abbott.com
    Africa, Russia & CIS / Afrika, Russland & CIS / África, Rusia y CEI / Afrique, Russie & CIS
    / Africa, Russia & CIS / África, Rússia e CEI / Африка, Россия и СНГ
    +27 10 500 9700 | ARCISproductsupport@abbott.com
    Asia Pacific / Asien Pazifik / Asia Pacífico / Asie Pacifique / Asia Pacific / Ásia-Pacífico / Азия, Океания +61 7 3363 7711 | APproductsupport@abbott.com
    Latin America / Lateinamerika / America Latina / Amérique Latine / Latin America / América Latina
    / Латинская Америка
    +57 2 661 8797 | LAproductsupport@abbott.com
    1 2 3 4 5 Hold the buffer bottle vertically and
    fill the extraction tube with buffer
    fluid until it flows up to the Fill-line
    of the extraction tube (300μl).
    Caution: If the amount of
    buffer is excessive or insufficient, an
    improper test result may occur.
    Sostenga el frasco de tampón
    verticalmente y llene el tubo de
    extracción con solución tampón
    hasta que fluya hasta la línea de
    llenado del tubo de extracción
    (300μL).
    Precaución: Si la cantidad de
    tampón es excesiva o insuficiente,
    puede producirse un resultado de
    prueba incorrecto.
    Tenere il flacone del buffer
    verticalmente e riempire la provetta
    di estrazione fino alla linea di
    riempimento della provetta di
    estrazione (300 µl).
    Attenzione: Se la quantità di
    buffer è eccessiva o insufficiente,
    potrebbe verificarsi un risultato di
    test errato.
    Держа флакон с буфером
    вертикально наполните
    экстракционную пробирку
    буферным раствором, пока она
    не дойдет до линии заполнения
    экстракционной пробирки (300
    мкл).
    Предупреждение: Если
    объем буфера чрезмерен или
    недостаточен, результат теста
    может быть неправильным.
    Halten Sie das Pufferfläschchen
    vertikal und füllen Sie das
    Extraktionsröhrchen mit
    Pufferflüssigkeit, bis die Fülllinie des
    Extraktionsröhrchens erreicht ist
    (300 μl).
    Achtung: Bei einer zu hohen oder
    geringen Puffermenge sind falsche
    Testergebnisse möglich.
    Tenez le flacon de tampon
    verticalement et remplissez le tube
    d’extraction avec du liquide tampon
    jusqu’à ce qu’il s’écoule jusqu’à la ligne
    de remplissage du tube d’extraction
    (300 μl).
    Attention: Si la quantité de
    tampon est excessive ou insuffisante,
    un résultat de test incorrect peut se
    produire.
    Segure o frasco de tampão
    verticalmente e encha o tubo de
    extração com fluido de tampão
    até que ele flua até a linha de
    enchimento do tubo de extração
    (300μL).
    Cuidado: Se a quantidade de
    tampão for excessiva ou insuficiente,
    um resultado de teste impróprio
    pode ocorrer.
    Break the swab at
    the breakpoint and
    close the cap of
    extraction tube.
    Tilt the patient’s head back.
    Insert the swab through the
    nostril. Gently rub and roll
    the swab, 3-4 times. Leave
    the swab in place for several
    seconds. Slowly remove swab. Quiebre el hisopo en
    el punto de ruptura
    y cierre la tapa del
    tubo de extracción.
    Incline la cabeza del paciente
    hacia atrás. Inserte el hisopo a
    traves de la fosa nasal. Frote y
    gire suavemente el hisopo, 3 a
    4 veces. Deje el hisopo en su
    lugar durante varios segundos.
    Retire lentamente el hisopo.
    Spezzare il tampone
    nel punto di rottura
    e chiudere il tappo
    della provetta di
    estrazione.
    Inclinare la testa del paziente
    all’indietro. Inserire il tampone
    attraverso la narice. Strofinare
    e ruotare delicatamente il
    tampone 3-4 volte. Lasciare il
    tampone in posizione per alcuni
    secondi. Rimuovere lentamente
    il tampone.
    Тампон
    разламывают в
    точке разлома,
    и колпачок
    для пробирки
    экстракционной
    закрывают.
    Наклоняют голову пациента
    назад. Вставляют тампон
    через. Аккуратно потрите
    поверхность тампоном и
    поверните его 3-4 раза.
    Оставляют тампон на
    несколько секунд. Медленно
    извлекают тампон.
    Brechen Sie den Tupfer
    an der Bruchstelle
    ab und schließen
    Sie den Deckel des
    Extraktionssröhrchens.
    Neigen Sie den Kopf des
    Patienten nach hinten. Führen
    Sie den Tupfer durch das
    Nasenloch ein. Reiben und
    rollen Sie den Tupfer vorsichtig
    3-4 Mal. Lassen Sie den Tupfer
    für einige Sekunden an Ort
    und Stelle. Entfernen Sie den
    Tupfer langsam.
    Cassez l’écouvillon au
    point de rupture et
    fermez le capuchon
    du tube d’extraction.
    Inclinez la tête du patient en
    arrière. Insérez l’écouvillon
    dans la narine. Frottez et
    roulez doucement l’écouvillon,
    3 à 4 fois. Laissez l’écouvillon
    en place pendant plusieurs
    secondes. Retirez lentement
    l’écouvillon.
    Quebre o swab no
    ponto de quebra e
    feche a tampa do
    tubo de extração.
    Incline a cabeça do paciente
    para trás. Insira o swab pela
    narina. Esfregue e role
    suavemente o swab, 3-4 vezes.
    Deixe o swab no lugar por
    alguns segundos. Remova o
    swab lentamente.
    Place the
    extraction tube
    in the tube
    rack.
    Coloque el tubo
    de extracción
    en la gradilla
    para tubos.
    Posizionare
    la provetta
    di estrazione
    nel rack
    portaprovette.
    Установите
    экстракционную
    пробирку в
    штатив.
    Stellen Sie das
    Extraktionsröhrchen
    in den
    Röhrchenständer.
    Placez le tube
    d’extraction
    dans le support
    de tubes.
    Coloque o tubo
    de extração
    no suporte de
    tubos.
    Insert the swab specimen in the
    extraction tube. Swirl the swab tip in the
    buffer fluid inside the extraction tube,
    pushing into the wall of the extraction
    tube at least five times and then squeeze
    out the swab by squeezing the extraction
    tube with your fingers.
    Inserte la muestra de hisopado en el tubo
    de extracción. Gire la punta del hisopo
    en la solución tampón dentro del tubo de
    extracción, empujando hacia la pared del
    tubo de extracción al menos cinco veces
    y luego exprima el hisopo apretando el
    tubo de extracción con los dedos.
    Inserire il tampone di campionamento
    nella provetta di estrazione. Ruotare la
    punta del tampone nel liquido all’interno
    della provetta di estrazione, spingendo
    sulla parete della provetta di estrazione
    almeno cinque volte e poi premere
    il tampone strizzando la provetta di
    estrazione con le dita.
    Вставьте тампон с образцом
    в экстракционную пробирку.
    Наконечник тампона
    проворачивают в буферном
    растворе внутри экстракционной
    пробирки, вдавливая его в стенку
    экстракционной пробирки не менее
    пяти раз, а затем тампон выжимают,
    сдавливая экстракционную
    пробирку пальцами.
    Führen Sie die Abstrichprobe in das
    Extraktionsröhrchen ein. Schwenken Sie
    die Tupferspitze in der Pufferflüssigkeit
    des Extraktionsröhrchens. Drücken Sie
    dabei den Tupfer mindestens fünfmal an
    die Wand des Extraktionsröhrchens und
    drücken Sie anschließend denn Tupfer
    aus, indem Sie mit den Fingern das
    Extraktionsröhrchen zusammendrücken.
    Insérez l’échantillon sur écouvillon dans le
    tube d’extraction. Faites tourbillonner la
    pointe de l’écouvillon dans le fluide tampon
    à l’intérieur du tube d’extraction, en
    poussant dans la paroi du tube d’extraction
    au moins cinq fois, puis faites sortir
    l’écouvillon en pressant le tube d’extraction
    avec vos doigts.
    Insira a amostra de esfregaço no tubo de
    extração. Gire a ponta do swab no fluido
    tampão dentro do tubo de extração,
    empurrando na parede do tubo de extração
    pelo menos cinco vezes e, em seguida,
    aperte o swab apertando o tubo de
    extração com os dedos.
    x 5

    1 Allow all kit components to reach a temperature
    between 15-30°C prior to testing for 30
    minutes.
    Note: Healthcare professionals should comply
    with personal safety guidelines including the use
    of personal protective equipment.
    Laissez tous les composants du kit atteindre une
    température comprise entre 15 et 30 ° C avant de
    procéder au test pendant 30 minutes.
    Remarque: le professionnel de santé doit se
    conformer aux directives de sécurité personnelle,
    y compris l’utilisation d’équipements de protection
    individuelle.
    Перед тестированием выдержите все компоненты
    набора в течение 30 минут при температуре 15-30 °C
    Примечание: Медицинский работник должен
    соблюдать правила техники безопасности, включая
    использование средств индивидуальной защиты.
    Lassen Sie alle Komponenten des Test-Kits 30
    Minuten vor Beginn des Testens eine Temperatur
    von 15-30°C erreichen.
    Hinweis: Das medizinische Personal sollte die
    persönlichen Sicherheitsrichtlinien einschließlich
    der Verwendung persönlicher Schutzausrüstung
    einhalten.
    Consentire a tutti i componenti del kit di
    raggiungere una temperatura tra 15-30°C per
    30 minuti prima dell’esecuzione del test.
    Nota: Gli operatori sanitari devono rispettare le
    linee guida per la sicurezza personale, incluso l’uso
    di dispositivi di protezione personale.
    Permita que todos los componentes del kit
    alcancen una temperatura entre 15 y 30 °C
    durante 30 minutos antes de realizar la prueba.
    Note: Los profesional de la salud deben cumplir
    con las pautas de seguridad personal, incluido el
    uso de equipo de protección personal.
    Deixe todos os componentes do kit atingirem
    uma temperatura entre 15-30°C antes do teste
    por 30 minutos.
    Nota: Profissionais de saúde devem cumprir as
    diretrizes de segurança pessoal, incluindo o uso
    de equipamento de proteção individual.

    GLOSSARY OF SYMBOLS / SYMBOLVERZEICHNIS / GLOSARIO DE SÍMBOLOS / GLOSSAIRE DES SYMBOLES / GLOSSARIO DEI SIMBOLI
    / GLOSSÁRIO DE SÍMBOLOS / ГЛОССАРИЙ ОБОЗНАЧЕНИЙ
    Temperature limitation
    Temperaturbegrenzung
    Limitación de temperatura
    Limitation de température
    Limitazione di temperatura
    Limitação de temperatura
    Температурный диапазон
    For in vitro diagnostic use only
    Medizinprodukt für in-vitro Diagnostik
    Sólo para uso diagnóstico in vitro
    Pour un usage de diagnostic in vitro uniquement
    Ad uso esclusivo diagnostico in vitro
    Somente para uso para diagnóstico in vitro
    Медицинское изделие для диагностики In Vitro
    Do not reuse
    Nicht wiederverwenden
    No reutilizar
    Ne pas réutiliser
    Non riutilizzare
    Não reutilizar
    Не использовать повторно
    Use By
    Verwendbar bis
    Usar por
    Utiliser par
    Utilizzare per
    Usar até
    Использовать до
    Contains sufficient for X tests
    Ausreichend für X Prüfungen
    Contiene suficiente para X pruebas
    Contient suffisamment pour les tests X
    Contenuto sufficiente per X test
    Contém suficiente para X testes
    Содержит материалы, достаточные для
    выполнения Х тестов
    Date of manufacture
    Herstellungsdatum
    Fecha de manufactura
    Date de fabrication
    Data di produzione
    Data de fabricação
    Дата производства
    Catalog Number
    Artikelnummer
    Número de catalogo
    Numéro de catalogue
    Numero di catalogo
    Número no Catálogo
    Каталожный номер
    Lot Number
    Chargencode
    Número de lote
    Numéro de lot
    Numero di lotto
    Número de Lote
    Номер серии
    Manufacturer
    Hersteller
    Fabricante
    Fabricant
    Produttore
    Fabricante
    Производитель
    Consult instructions for use
    Gebrauchsanleitung beachten
    Consultar instrucciones de uso
    Consulter les instructions d’utilisation
    Consultare le istruzioni per l’uso
    Consulte as instruções de uso
    См. Инструкцию по применению
    Keep dry
    Trocken aufbewahren
    Mantener seco
    Garder au sec
    Mantenere asciutto
    Manter seco
    Хранить в сухом месте
    Biological Risks
    Biologisches Risiko
    Riesgos biológicos
    Risques biologiques
    Rischi biologici
    Riscos Biológicos
    Биологическая опасность
    Keep away from sunlight
    Von Sonnenlicht fernhalten
    Mantener alejado de la luz solar
    Tenir à l’écart de la lumière du soleil
    Tenere lontano dalla luce solare
    Manter longe da luz solar
    Беречь от попадания солнечных лучей
    Do not use if package is damaged
    Bei beschädigter Verpackung nicht verwenden
    No lo use si el paquete está dañado
    Ne pas utiliser si le colis est endommagé
    Non utilizzare se la confezione è danneggiata
    Não use se o pacote estiver danificado
    Не используйте, если упаковка
    повреждена
    Caution
    Achtung
    Precaución
    Attention
    Attenzione
    Cuidado
    Предупреждение
    CE mark
    CE Zeichen
    Marca CE
    Marquage CE
    Marcatura CE
    Marca CE
    Знак соответствия продукции техническим
    регламентам ЕС
    Do not re-sterilize
    Nicht sterilisieren
    No volver a esterilizar
    Ne pas re-stériliser
    Non risterilizzare
    Não reesterilize
    Не стерилизуйте повторно
    Sterilized using irradiation
    Sterilisiert durch Bestrahlung
    Esterilizado mediante irradiación.
    Stérilisé par irradiation
    Sterilizzato con irradiazione
    Esterilizado por irradiação
    Стерилизовано с использованием
    облучения
    Sterilized using ethylene oxide
    Sterilisiert mit Ethylenoxid
    Esterilizado con óxido de etileno.
    Stérilisé à l’oxyde d’éthylène
    Sterilizzato con ossido di etilene
    Esterilizado com óxido de etileno
    Стерилизовано окисидом этилена
    DRAFT
    About the Test
    Introduction
    The Coronavirus disease (COVID-19) is an infectious disease caused by a newly discovered coronavirus, severe acute
    respiratory syndrome coronavirus 2 (SARS-CoV-2)1
    . The SARS-CoV-2 is a β-coronavirus, which is an enveloped nonsegmented positive-sense RNA virus2
    . It is spread by human-to-human transmission via droplets or direct contact,
    and infection has been estimated to have a mean incubation period of 6.4 days and a basic reproduction number of
    2.24-3.58. Among patients with pneumonia caused by SARS-CoV-2, fever was the most common symptom, followed
    by cough3
    . The main IVD assays used for COVID-19 employ real-time reverse transcriptase-polymerase chain reaction
    (RT-PCR) that takes a few hours4
    . The availability of a cost-effective, rapid point-of-care diagnostic test is critical to
    enable healthcare professionals to aid in the diagnosis of patients and prevent further spread of the virus5
    . Antigen tests
    will play a critical role in the fight against COVID-196
    .
    Test Principle
    Panbio™ COVID-19 Ag Rapid Test Device contains a membrane strip, which is pre-coated with immobilized antiSARS-CoV-2 antibody on the test line and mouse monoclonal anti-chicken IgY on the control line. Two types of
    conjugates (human IgG specific to SARS-CoV-2 Ag gold conjugate and chicken IgY gold conjugate) move upward
    on the membrane chromatographically and react with anti-SARS-CoV-2 antibody and pre-coated mouse monoclonal
    anti-chicken IgY respectively. For a positive result, human IgG specific to SARS-CoV-2 Ag gold conjugate and antiSARS-CoV-2 antibody will form a test line in the result window. Neither the test line nor the control line are visible in
    the result window prior to applying the patient specimen. A visible control line is required to indicate a test result is valid.
    Intended Use
    Panbio™ COVID-19 Ag Rapid Test Device is an in vitro diagnostic rapid test for the qualitative detection of SARSCoV-2 antigen (Ag) in human nasopharyngeal swab specimens from individuals who meet COVID-19 clinical and / or
    epidemiological criteria. Panbio™ COVID-19 Ag Rapid Test Device is for professional use only and is intended to be
    used as an aid in the diagnosis of SARS-CoV-2 infection. The product may be used in any laboratory and non-laboratory
    environment that meets the requirements specified in the Instructions for Use and local regulation.
    The test provides preliminary test results. Negative results don’t preclude SARS-CoV-2 infection and they cannot be
    used as the sole basis for treatment or other management decisions. Negative results must be combined with clinical
    observations, patient history, and epidemiological information. The test is not intended to be used as a donor screening
    test for SARS-CoV-2.
    Materials Provided
    • 25 Test devices with desiccant in individual foil pouch
    • Buffer (1 x 9 ml/bottle)
    • 25 Extraction tubes
    • 25 Extraction tube caps
    • 1 Positive control swab
    • 1 Negative control swab
    • 25 Sterilized nasopharyngeal swabs for sample collection
    • 1 Tube rack
    • 1 Quick reference guide (Nasopharyngeal)
    • 1 Instructions for use
    Materials Required but not Provided
    • Personal Protective Equipment, Timer, Biohazard container
    Active Ingredients of Main Components
    • 1 Test device
    Gold conjugate: Human IgG specific to SARS-CoV-2 Ag gold colloid and Chicken IgY – gold colloid, Test line:
    Mouse monoclonal anti-SARS-CoV-2, Control line: Mouse monoclonal anti-Chicken IgY
    • Buffer
    Tricine, Sodium Chloride, Tween 20, Sodium Azide (<0.1%), Proclin 300
    Storage and Stability
  11. The test kit should be stored at a temperature between 2-30 °C. Do not freeze the kit or its components.
    Note: When stored in a refrigerator, all kit components must be brought to room temperature (15-30 °C)
    for a minimum of 30 minutes prior to performing the test. Do not open the pouch while components come
    to room temperature.
  12. The Buffer bottle may be opened and resealed for each assay. The Buffer cap should be firmly sealed between
    each use. The Buffer is stable until expiration date if kept at 2-30 °C.
  13. Perform the test immediately after removing the test device from the foil pouch.
  14. Do not use the test kit beyond its expiration date.
  15. The shelf life of the kit is as indicated on the outer package.
  16. Do not use the test kit if the pouch is damaged or the seal is broken.
  17. Direct swab specimens should be tested immediately after collection. If immediate testing is not possible, the
    swab specimen can be kept in an extraction tube filled with extraction buffer (300 μl) at room temperature
    (15-30 °C) for up to two hours prior to testing.
    Warnings
  18. For in vitro diagnostic use only. Do not reuse the test device and kit components.
  19. These instructions must be strictly followed by a trained healthcare professional to achieve accurate results. All
    users have to read the instruction prior to performing a test.
  20. Do not eat or smoke while handling specimens.
  21. Wear protective gloves while handling specimens and wash hands thoroughly afterwards.
  22. Avoid splashing or aerosol formation of specimen and buffer.
  23. Clean up spills thoroughly using an appropriate disinfectant.
  24. Decontaminate and dispose of all specimens, reaction kits and potentially contaminated materials (i.e. swab,
    extraction tube, test device) in a biohazard container as if they were infectious waste and dispose according to
    applicable local regulations.
  25. Do not mix or interchange different specimens.
  26. Do not mix reagent of different lots or those for other products.
  27. Do not store the test kit in direct sunlight.
  28. To avoid contamination, do not touch the head of provided swab when opening the swab pouch.
  29. The provided sterilized swabs in the package should be used only for nasopharyngeal specimen collection.
  30. To avoid cross-contamination, do not reuse the sterilized swabs for specimen collection.
  31. Do not dilute the collected swab with any solution except for the provided extraction buffer.
  32. The buffer contains <0.1% sodium azide as a preservative which may be toxic if ingested. When disposed of
    through a sink, flush with a large volume of water.7
    Test Procedure (Refer to Figure)
    Nasopharyngeal Swab Specimens
    Note: Healthcare professionals should comply with personal safety guidelines including the use of personal protective
    equipment.
    Test Preparation
  33. Allow all kit components to reach a temperature between 15-30 °C prior to testing for 30 minutes.
  34. Remove the test device from the foil pouch prior to use. Place on a flat, horizontal and clean surface.
  35. Hold the buffer bottle vertically and fill the extraction tube with buffer fluid until it flows up to the Fill-line of
    the extraction tube (300 μl).
    Caution: If the amount of buffer is excessive or insufficient, an improper test result may occur.
  36. Place the extraction tube in the tube rack.
    Specimen Collection & Extraction
  37. Tilt the patient’s head back slightly about 45°-70° to straighten the passage from the front of the nose.
  38. Insert the swab with a flexible shaft through the nostril parallel to the palate.
    Caution: Use dedicated nasopharyngeal swab for specimen collection.
  39. Swab should reach depth equal to distance from nostrils to outer opening of the ear.
    Caution: If resistance is encountered during insertion of the swab, remove it and attempt insertion in the
    opposite nostril.
  40. Gently rub and roll the swab, 3-4 times. Leave the swab in place for several seconds to absorb secretions.
  41. Slowly remove swab while rotating it and insert into the extraction tube.
  42. Swirl the swab tip in the buffer fluid inside the extraction tube, pushing into the wall of the extraction tube at
    least five times and then squeeze out the swab by squeezing the extraction tube with your fingers.
  43. Break the swab at the breakpoint and close the cap of extraction tube.
    Reaction with Test Device
  44. Open the dropping nozzle cap at the bottom of the extraction tube.
  45. Dispense 5 drops of extracted specimens vertically into the specimen well (S) on the device. Do not handle or
    move the test device until the test is complete and ready for reading.
    Caution: Bubbles that occur in the extraction tube can lead to inaccurate results. If you are unable to create
    sufficient drops, this may be caused by clogging in the dispensing nozzle. Shake the tube gently to release the
    blockage until you observe free drop formation.
  46. Close the nozzle and dispose of the extraction tube containing the used swab according to your local regulations
    and biohazard waste disposal protocol.
  47. Start timer. Read result at 15 minutes. Do not read results after 20 minutes.
  48. Dispose of the used device according to your local regulations and biohazard waste disposal protocol.
    Positive / Negative Control Swab
  49. Hold the buffer bottle vertically and fill the extraction tube with buffer fluid until it flows up to the Fill-line of
    the extraction tube (300 μl).
    Caution: If the amount of buffer is excessive or insufficient, an improper test result may occur.
  50. Place the extraction tube in the tube rack.
  51. Insert the positive or negative control swab in the buffer fluid inside of the extraction tube and soak the swab
    for 1 minute. Swirl the control swab tip in the buffer fluid inside of the extraction tube, pushing into the wall of
    the extraction tube at least five times and then squeeze out the swab by squeezing the extraction tube with
    your fingers.
  52. Dispose of the used control swab in accordance with your biohazard waste disposal protocol.
  53. Close the cap of the extraction tube.
  54. Follow the above test procedure [Reaction with Test Device].
    Test Interpretation (Refer to Figure)
  55. Negative result: The presence of only the control line (C) and no test line (T) within the result window indicates
    a negative result.
  56. Positive result: The presence of the test line (T) and the control line (C) within the result window, regardless of
    which line appears first, indicates a positive result.
    Caution: The presence of any test line (T), no matter how faint, indicates a positive result.
  57. Invalid result: If the control line (C) is not visible within the result window after performing the test, the result
    is considered invalid.
    Test Limitations
  58. The contents of this kit are to be used for the professional and qualitative detection of SARS-CoV-2 antigen
    from nasopharyngeal swab. Other specimen types may lead to incorrect results and must not be used.
  59. Failure to follow the instructions for test procedure and interpretation of test results may adversely affect test
    performance and/or produce invalid results.
  60. A negative test result may occur if the specimen was collected, extracted or transported improperly. A negative
    test result does not eliminate the possibility of SARS-CoV-2 infection and should be confirmed by viral culture
    or a molecular assay or ELISA.
  61. Positive test results do not rule out co-infections with other pathogens.
  62. For further information on immune status, additional follow-up testing using other laboratory methods is
    recommended.
  63. Test results must be evaluated in conjunction with other clinical data available to the physician.
  64. Reading the test results earlier than 15 minutes or later than 20 minutes may give incorrect results.
  65. Panbio™ COVID-19 Ag Rapid Test Device is not intended to detect from defective (non-infectious) virus
    during the later stages of viral shedding that might be detected by PCR molecular tests.8
  66. Positive results may occur in cases of infection with >2.5 ng/mL SARS-CoV.
    Quality Control
  67. Internal Quality Control:
    The test device has a test line (T) and a control line (C) on the surface of the test device. Neither the test line nor the
    control line are visible in the result window before applying a specimen. The control line is used for procedural control and
    should always appear if the test procedure is performed properly and the test reagents of the control line are working.
  68. External Quality Control:
    The controls are specifically formulated and manufactured to ensure performance of the Panbio™ COVID-19 Ag Rapid
    Test Device and are used to verify the user’s ability to properly perform the test and interpret the results. The Positive
    Control will produce a positive test result and has been manufactured to produce a visible test line (T). The Negative
    Control will produce a negative test result.
    Good laboratory practice suggests the use of positive and negative controls to ensure that:
    • Test reagents are working, and
    • The test is correctly performed.
    Run the external controls under the following circumstances:
    • With each new operator prior to performing testing on patient specimens,
    • When receiving a new test shipment,
    • At periodic intervals as dictated by local, state and country requirements, and/or by the user’s Quality Control
    procedures.
    Performance Characteristics
  69. External evaluation of Panbio™ COVID-19 Ag Rapid Test Device
    Clinical performance of Panbio™ COVID-19 Ag Rapid Test Device was determined by testing 140 positive and
    445 negative specimens for SARS-CoV-2 antigen (Ag) to have a sensitivity of 91.4% (95% CI: 85.5-95.5%) and
    specificity of 99.8% (95% CI: 98.8-100%). Clinical specimens were determined to be positive or negative using an
    FDA EUA RT-PCR reference method.
    Panbio™ COVID-19 Ag Rapid Test Device Results
    PCR Test Result
    Positive Negative Total
    Panbio™ COVID-19 Ag
    Rapid Test Device Results
    Positive 128 1 129
    Negative 12 444 456
    Total 140 445 585
    Sensitivity Specificity Overall Percent
    Agreement
    91.4%
    [85.5%;95.5%]
    99.8%
    [98.8%;100%]
    97.8%
    [96.2%;98.8%]
    • Performance data was calculated from a study of individuals suspected of exposure to COVID-19 or who
    have presented with symptoms in the last 7 days.
    • Stratification of the positive specimens post onset of symptoms or suspected exposure between 0-3 days
    has a sensitivity of 94.9% (n=39) and 4-7 days has a sensitivity of 90.1% (n=101).
    • Positive agreement of the Panbio™ COVID-19 Ag Rapid Test Device is higher with samples of Ct values
    ≤33 with a sensitivity of 94.1%. As suggested in References 8 and 9, patients with Ct value >33 are no
    longer contagious.8, 9
  70. Detection Limit
    Panbio™ COVID-19 Ag Rapid Test Device was confirmed to detect 2.5X101.8 TCID50/ml of SARS-CoV-2
    which was isolated from a COVID-19 confirmed patient in Korea.
  71. Hook Effect
    There is no hook effect at 1.0×105.8 TCID50/ml of SARS- CoV-2 which was isolated from a COVID-19
    confirmed patient in Korea.
  72. Cross Reactivity
    Cross-reactivity of Panbio™ COVID-19 Ag Rapid Test Device was evaluated by testing 25 viruses and 14
    other microorganisms. The final test concentrations of viruses and other microorganisms are documented
    in the Table below. The following viruses and other microorganisms except the Human SARS-coronavirus
    Nucleoprotein have no effect on the test results of Panbio™ COVID-19 Ag Rapid Test Device.
    Panbio™ COVID-19 Ag Rapid Test Device has cross-reactivity with Human -SARS-coronavirus
    Nucleoprotein at a concentration of 25 ng/ml or more because SARS-COV has high homologous (79.6%)
    to the SARS-COV-2.
    No. Types of
    Specimen Cross Reaction Substance Final Test Concentration Test Result
    1
    Virus
    Adenovirus Type3 2.0 X 106.5 TCID50/ml No cross reaction
    2 Adenovirus Type7 2.0 X 104.75 TCID50/ml No cross reaction
    3 Echovirus2 1.0 X 106.5 TCID50/ml No cross reaction
    4 Echovirus11 2.0 X105.25 TCID50/ml No cross reaction
    5 Human herpesvirus (HSV) 1 2.0 X 106.25 TCID50/ml No cross reaction
    6 Human herpesvirus (HSV) 2 2.0 X 104.75 TCID50/ml No cross reaction
    7 Mumps Virus Ag 2.0 X 103.5 TCID50/ml No cross reaction
    8 Influenza virus A (H1N1) Strain (A/Virginia/
    ATCC1/2009) 2.6 X 105.0 PFU/ml No cross reaction
    9 Influenza virus A (H1N1) Strain (A/WS/33) 5.0 X 107.25 TCID50/ml No cross reaction
    10 Influenza virus A(H3N2) Strain (A/Hong
    Kong/8/68) N/A* No cross reaction
    11 Influenza virus B Strain (B/Lee/40) 2.0 X 105.25 TCID50/ml No cross reaction
    12 Parainfluenza Type 1 N/A* No cross reaction
    13 Parainfluenza Type 2 N/A* No cross reaction
    14 Parainfluenza Type 3 N/A* No cross reaction
    15 Parainfluenza Type 4A 1.97 X 107.0 PFU/mL No cross reaction
    16 Respiratory syncytial virus (RSV) type A 4.22 X 105.0 TCID50/ml No cross reaction
    17 Respiratory syncytial virus (RSV) type B 5.62 X 105.0 TCID50/ml No cross reaction
    18 HCoV-HKU1 10 ug/ml No cross reaction
    19 Rhinovirus A16 8.8 X 105.0 PFU/mL No cross reaction
    20 HCoV-NL63 1.7 X 105.0 TCID50/ml No cross reaction
    21 HCoV-OC43 8.9 X 105.0 TCID50/ml No cross reaction
    22 HCoV-229E 1.51 X 106.0 TCID50/ml No cross reaction
    23 Human SARS-coronavirus Nucleoprotein 25 ng/ml Cross reaction
    24 MERS-CoV Nucleoprotein 0.25 mg/ml No cross reaction
    25 Human Metapneumovirus (hMPV) 16
    Type A1 1.06 X 106.0 PFU/mL No cross reaction
    1
    Other
    Microorganism
    Staphylococcus aureus 1.0 X 106.0 CFU/ml No cross reaction
    2 Staphylococcus saprophyticus 1.0 X 106.0 CFU/ml No cross reaction
    3 Neisseria sp.(Neisseria lactamica) 1.0 X 106.0 CFU/ml No cross reaction
    4 Escherichia coli 1.0 X 106.0 CFU/ml No cross reaction
    5 Staphylococcus haemolyticus 1.0 X 106.0 CFU/ml No cross reaction
    6 Streptococcus pyogenes 1.0 X 106.0 CFU/ml No cross reaction
    7 Streptococcus salivarius 1.0 X 106.0 CFU/ml No cross reaction
    8 Hemophilus parahaemolyticus 1.0 X 106.0 CFU/ml No cross reaction
    9 Proteus vulgaris 1.0 X 106.0 CFU/ml No cross reaction
    10 Moraxella catarrhalis 1.0 X 106.0 CFU/ml No cross reaction
    11 Klebsiella pneumoniae 1.0 X 106.0 CFU/ml No cross reaction
    12 Fusobacterium necrophorum 1.0 X 106.0 CFU/ml No cross reaction
    13 Mycobacterum tuberculosis 10 mg/ml No cross reaction
    14 Pooled human nasal wash N/A No cross reaction

Saliva easy test Invbio

The Invbio Covid (SARS-Cov-2) Antigen Rapid 25 Tests Device (Saliva) explained


Developped in 2021 this easy Corona virus (SARS-Cov2) Antigen Test Device, 25 tests a box on Saliva and sputum is an in vitro diagnostic test for the qualitative detection of covid antigens in human sputum and saliva, using the rapid immuno-chromatographic lateral flow method with a Genprice casette device. These casettes are disposable.

The identification is based on mouse monoclonal antibodies specific for the covid antigen. If you are anigen positive you are at risk to infect other people or animals like cats.

How does the saliva COVID-19 Rapid Test Device of Invbio works?

  1. One line on the C of control means negative
  2. Two lines one on the Ag and one on the control means positive
  3. No lines mean the test failed

Buy the not painful Antigen Rapid Test Devices for Saliva

  1. CE Mark and EUA for USA Emmergency Use Authorisation.
  2. Not FDA approved in februari 2021
  3. Relative sensitivity: 96.17 %
  4. Relative specificity: >99.9%
  5. Accuracy:98.79%%
  6. Specimen: Saliva, 10-20 minutes to get results
  7. perect for kids

Innovation Biotech (Beijing) Co.,Ltd is a biotechnology company specializing in research, development and manufacturing of advanced medical in-vitro diagnostic (IVD) rapid test kits, medical and laboratory disposal products. We provide one step medical diagnostic rapid test kit based on our INVBIO brand, Product include Fertility Tests, Infectious diseases, Tumor markers, DOA drug of abuse test, Drug test cup, Urinalysis reagent strip, ELISA kit, Digital alcohol tester, urine analyzer, et.

OEM packaging is available, drug of abuse test, troponin I test, alcohol screening saliva test strips, urine strips, elisa kits, microscope slides

Our focus is to expand our markets internationally by forming strategic alliances and entering into partnerships with distributors worldwide. We have established an international reputation for excellence in the manufacturing of quality medical and laboratory products. In addition, we have obtained approval licenses ISO13485, FSC certificate, and most of our products get CE mark Our objective is the utmost satisfaction of our clients all around the world by supplying our quality and economical products
 
It is the policy of Innovation Biotech (Beijing) Co., Ltd to achieve the highest degree of product quality, we ensuring that processes and services are continually improved in line with customer requirements.

This winter there will be no Pcr diagnostic detection like before the 90′ due to Filtertip shortage

Due to elevated use of Pcr there is a worldwide shortage of 1000ul and 1250ul pcr filter suggestions for dna amplification.
Big distributors like Gentaur had already construct up a filter tip inventory to proceed supplying filter suggestions to diagnostic and forensic laboratories however this inventory is already missing the giant filter suggestions. Small filter suggestions are nonetheless out there.
Aparrently this will not be adequate since the worlds demand in suggestions has elevated to quick due to elevated corona detection with Pcr.
Pcr, polymerase chain response is a method to amplify Dna utilizing a Thermocycler workstation and TAQ polymerase. (Enzyme from the micro organism Thermus Aquaticus)
Pcr is utilized in forensic laboratories, diagnostic laboratories and analysis laboratories. Detection of most cancers varistions, HPV human papillomavirus and Tuberculosis resistence with spolygotyping rely on PCR.
Gentaur initially equipped filter suggestions from Neptune Scientific, in San Diego Ca, manufactured in Mexico. Our import is now restricted to 10 containers a month however we’d like 500 containers.
There are solely little filter tip crops out there in the world. Belgium, Poland have any manufacturing since our filter suggestions are made in Germany by Greiner, Corning, …
Gentaur tried to supply filter suggestions in India however the Indian govrnment has in september 2020 put a ban on export of filter suggestions. The container with filter suggestions already despatched to Europe had been recalled to return to Mumbai, Accumaximum the Indian producer.
With no filter suggestions out there in USA, Europe and India Gentaur is now making an attempt to import filter suggestions from China however massive Laboratories like Synlab have already precedence with the Chinese producers.
It will be a troublesome winter for our forensic, diagnostic and analysis clients say Lieven Gevaert, the director of Gentaur Bvba in Kampenhout.
Our laboratory clients may swith tp work with smaller volumes since 10 ul filter suggestions are nonetheless out there, but when these will be out of inventory they will be technically unemployed.
Since the 90s Pcr has turn out to be an increasing number of essential in our scientific laboratories. I can’t think about this winter we will return to a state of affairs of before the 90s the place criminals can’t be traced anymore, most cancers can’t be characterised and virusses not detected.
There are nonetheless the antigen and antibody detection strategy of Covid however this lacks in detection pace from the day somebody received contaminated by covid.
Pcr can detect as early as in 2 days, antigen 3 to four days and antibody 5 to 7 days after a persons’ contact with an Covid contamination.

Cellufine affinity column

C-Peptide

E64I002 0.1mg
EUR 1675

JNC products are manufactured in Japan. To obtain the msds contact Gentaur.

C-Peptide

E64I002 0.1mg
EUR 1675

C-Peptide

E64I00201 0.1mg
EUR 424

Cellufine information

Recombinant Borrelia burgdorferi Osp-C protein (OSP-C) control for Western blot

OSPC12-C 100 ul
EUR 286

FD Rapid GolgiStain™ kit - Solution C

PK401-C 250 ml
EUR 185.77
Description: Best quality products

Histofine

For Human Tissue Sections

-1 Step Polymer Detection Systems Liquid. Ready to use.
Product Name Slides Volume Code For use with Instruction SDS Mark in EU
-Histofine® Simple Stain™ MAX PO (MULTI) 170 1x17ml 414151F Mouse and rabbit
primary antibodies
PDF CE SDS
CE

  • 500 3x17ml 414152F
  • 1500 9x17ml 414154F
  • -Histofine® Simple Stain™ MAX PO (M) 170 1x17ml 414131F Mouse
  • primary antibody PDF
  • PDF CE
  • 500 3x17ml 414132F
  • 1500 9x17ml 414134F
  • -Histofine® Simple Stain™ MAX PO (R) 170 1x17ml 414141F Rabbit
  • primary antibody PDF
  • PDF CE
  • 500 3x17ml 414142F
  • 1500 9x17ml 414144F
  • -Histofine® Simple Stain™ MAX PO (G) 170 1x17ml 414161F Goat
  • primary antibody PDF
  • 500 3x17ml 414162F
  • -Histofine® Simple Stain™ AP (MULTI) 170 1x17ml 414261F Mouse and rabbit
  • primary antibodies PDF
  • 500 3x17ml 414262F
  • -Histofine® Simple Stain™ AP (M) 170 1x17ml 414241F Mouse
  • primary antibody PDF
  • 500 3x17ml 414242F
  • -Histofine® Simple Stain™ AP (R) 170 1x17ml 414251F Rabbit
  • primary antibody PDF
  • 500 3x17ml 414252F


For Human Tissue Sections

-High Sensitive 2 Step Polymer Detection Systems Liquid. Ready to use.
Product Name Slides Volume Code For use with Instruction/SDS
-Histofine® High Stain™ HRP (MULTI) NEW 170 1x17ml
each 414481F Mouse and
rabbit
primary
antibodies PDFSDS
1000 6x17ml
each 414483F


For Mouse Tissue Sections Liquid. Ready to use.

Product Name Slides Volume Code For use with Instruction SDS
-Histofine® Simple Stain™ Mouse MAX PO (R) 170 17ml 414341F Rabbit
primary antibody PDF SDS
-Histofine® Simple Stain™ Mouse MAX PO (G) 170 17ml 414351F Goat
primary antibody PDF
-Histofine® Simple Stain™ Mouse MAX PO (Rat) 170 17ml 414311F Rat
primary antibody PDF
-Histofine® MOUSESTAIN KIT 50 3x6ml 414321F Mouse
primary antibody PDFSDS
500 9x17ml 414322F
Blocking Reagent A
Blocking Reagent B
Simple Stain Mouse MAX PO (M)


For Rat Tissue Sections

Liquid. Ready to use.
Product Name Slides Volume Code For use with Instruction SDS
-Histofine® Simple Stain™ Rat MAX PO (MULTI) 170 17ml 414191F Mouse and rabbit
primary antibodies PDF SDS
-Histofine® Simple Stain™ Rat MAX PO (M) 170 17ml 414171F Mouse
primary antibody PDF
-Histofine® Simple Stain™ Rat MAX PO (R) 170 17ml 414181F Rabbit
primary antibody PDF
-Histofine® Simple Stain™ Rat MAX PO (G) 170 17ml 414331F Goat
primary antibody PDF
Peroxidase Chromogen/Substrate Solution, DAB
Product Name Slides Volume Code Instruction SDS Mark in EU
-Histofine® DAB-3S kit 500 1x3ml 415192F PDF
PDF CE SDS CE
1500 3x9ml 415194F
Reagent A: DAB solution concentrate
Reagent B: Enhancer solution concentrate
Reagent C: Hydrogen peroxide solution concentrate
-Histofine® DAB-2V NEW 500 Reagent A: 1 x 1.2 ml
Reagent B: 2 x 30 ml 425312F PDFSDS
PDF CE CE
1500 Reagent A: 6 x 1.2 ml
Reagent B: 6 x 30 ml 425314F
Reagent A: DAB solution concentrate
Reagent B: DAB buffer
Peroxidase Chromogen/Substrate Solution, AEC Liquid. Ready to use.
Product Name Slides Volume Code Instruction/SDS Mark in EU
-Histofine® Simple Stain™ AEC Solution 500 3x17ml 415182F PDFSDS CE
1500 9x17ml 415184F
Alkaline phosphatase Chromogen/Substrate Solution, New Fuchsin
Product Name Slides Volume Code Instruction/SDS
-Histofine® New Fuchsin Substrate Kit 2000 3x6ml,
1x12ml 415161F PDFSDS
Reagent A: New Fuchsin solution concentrate
Reagent B: Activating reagent concentrate
Reagent C: Substrate buffer concentrate
Reagent D: Substrate solution concentrate


ALK Detection Kit / ALK Control Slides

Product Name Slides Code Instruction/SDS
-Histofine® ALK Detection Kit 20 417071F PDFSDS

  • Vial NO.1:
  • Vial NO.2:
  • Vial NO.3:
  • Vial NO.4:
  • Vial NO.5:
  • Vial NO.6:
  • Vial NO.7:
  • Vial NO.8:
  • Vial NO.9:
  • Vial NO.10:
  1. Blocking Reagent
  2. Primary Antibody
  3. Negative Control
  4. Bridge Reagent
  5. Peroxidase Labeled Empower Reagent
  6. Chromogen Substrate
  7. Substrate Buffer Solution
  8. Chromogen Reagent
  9. ALK Antigen Retrieval Solution A
  10. ALK Antigen Retrieval Solution B


-Histofine® ALK Control Slides 5 417081F PDFSDS
Each slide contains two formalin fixed paraffin embedded cell lines,
NCI-H2228 (+: Positive) and SK-BR-3 (-: Negative).

Biotech References

Biotech Databases
Biotech Databases
Biotech research
1st BASE Singapore
4DXpress – a database for cross-species expression pattern comparisons
5 Prime, Inc.
5S rRNA – 5S ribosomal RNA Database
7TM – Entries of 7-transmembrane G-linked receptors in UniProtKB/Swiss-Prot
A Web of on-line dictionaries – Links to many dictionaries in a variety of languages
A.actinomycetemcomitans – Actinobacillus actinomycetemcomitans strain HK1651 genome project
A.pernix – Ignicoccus K1 genome Database
AAnP – IUPAC-IUBMB nomenclature for amino acids and peptides
AARSDatabase – Aminoacyl-tRNA synthetases Database
Abbreviations of chemical compounds
ABC – Agricultural Biotechnology Center (Budapest / Hungary)
Abcam – Supplier of antibodies, kits and reagents
ABCC – Advanced Biomedical Computing Center at the NCI
ABCISSE – ABC systems : Information on Sequence Structure and Evolution
ABIM – BioInformatics Workshop (Marseille / FR)
Accelrys, Inc
ACD – Advanced Chemistry Development, Inc.
ACGT – Advanced Center for Genome Technology at the University of Oklahoma
Acrendo Medical Softwware – A.I.med software for medical record and management
ACS – American Chemistry Society publications
Actelion
ACUTS – Ancient conserved untranslated DNA sequences Database
ADAbase – Human adenosine deaminase (ADA) mutation Database
ADAMTS – Apte lab ADAMTS and ADAMTSL resource
Addgene
Adenoviruses web site
ADInstruments – Data Acquisitions Systems for Life Science
AdvantechHealth – Electronic Medical Records products
AfDatabase – Archaeoglobus fulgidus genome Database at JCVI-CMR
Affymetrix, Inc.
AG BIODV – Software Development for Molecular Biology at Helmholtz Zentrum (Germany)
AGD 
AGRICOLA – AGRICultural OnLine Access; ref. Database from NAL
Airmid Pharmaceuticals – privately held pharmaceutical company based in California.
Alaken – Alaken, Inc.
Albinism Database
Albumin Web site
ALEXIS Biochemicals – Now Enzo Life Sciences
ALFRED – Allele Frequency Database
Alginate genes – Pseudomomonas alginate production genes
Algonomics
All the virology on the WWW – links to virology WWW servers by David M. Sander
Allen Press, Inc.
Allergen sequence Database
Allergome – A platform for allergen knowledge
Allgenes.org – Human predicted gene index/catalog
Alsod.org – ALS/SOD1 genetic mutations Database
Amgen
Amino acids 2 – Another information page on amino acids (from Berlin Free Univ.)
AMPL – Arabidopsis Membrane Protein Library
Amplicon Express
AMSBIO – Innovative products for genomics, proteomics and immunology
AMSDatabase – Antimicrobial sequences Database
Androgen Receptor Gene Mutations Database
ANGIS – Australian National Genomic Information Service
Annual Reviews
AnoDatabase – Anopheles gambiae Database
Antibodies online database
Antibodies Online Research Antibodies
Antibody Directory – A comprehensive portal for antibodies with a broad collection of research antibodies available world over
Antibody resource page – Links to antibody related Web resources
Antithrombin mutation Database
ANU – Australian National University Genomic Interactions group
AP – Academic Press has joined the Elsevier Group
APAF – Australian Proteome Analysis Facility
APBioNet – Asia-Pacific Bioinformatics network
APS – American Peptide Society
AR mutations – Human androgen receptor mutation Database
Arabidopsis at PlaCe – Site with info on P450, glucosyltransferases, etc.
Arabidopsis Glycosyltransferases Family 1
Arabidopsis P450 Web site
Arabidopsis UniProtKB/Swiss-Prot entries, gene names and WWW servers
AraC-XylS – A Database on a family of helix-turn-helix transcription factors from bacteria
ARCA biopharma
Archaea
ARIAD Pharmaceuticals, Inc.
ArkDatabase – Cat, Chicken, Cow, Deer, Horse, Pig, Quail, Sheep, Turkey genome databases
ArkDatabase – Sea Bass, Salmon genome databases
Arnold Publishers
Around UniProtKB – links to related databases and portals
ArrayExpress – MicroArray informatics at the EBI
ASCB Image & Video Library
ASCB – The American Society for Cell Biology
AsDatabase – Aberrant Splicing Database
ASHG – American Society of Human Genetics
Asia
ASM – American Society of Microbiology publications
Aspergillus nidulans Database
AstraZeneca Pharmaceuticals
ATC-LGCC – American Type Culture Collection
Atheris Laboratories
AureoList – Staphylococcus aureus strains N315 and Mu50 GenoList browser at Institut Pasteur
Aurora Fine Chemicals Ltd
Australia
B.aphidicola (subsp. Acyrthosiphon pisum) UniProtKB/Swiss-Prot entries, gene names and WWW servers
B.aphidicola (subsp. Schizaphis graminum) UniProtKB/Swiss-Prot entries, gene names and WWW servers
B.stearothermophilus – Bacillus stearothermophilus strain 10 genome project
B.subtilis UniProtKB/Swiss-Prot entries, gene names and WWW servers
B3E – Bioinformatics / Biostatistics / Biomathematics / Epidemiology (Paris / FR)
B6 – Information Bulletin of the Scientific Computing Service (Pasteur Institute / FR)
Back to TOP
Bacteria
Bacterial quorum sensing
Base4 Bioinformatics
Basel
Bayer
BbDatabase – Borrelia burgdorferi B31 genome Database at JCVI-CMR
Bcl-2 family database
BCM HGC – Baylor College of Medicine Human Genome Center
BD Biosciences – Becton, Dickinson and Co
BDGP – Berkeley Drosophila Genome Project
BeanGenes – Beans genome Database
Beckman Coulter Genomics
Belozersky Institute – GeneBee Molecular Biology server (Moscow); Russia EMBnet node
BEN – Belgium EMBnet node
Bend Research Inc. – Innovators in Pharmaceutical and Health Science Technologies
Bgee 
Biacore Life Sciences
BIC – BioInformatics Center of the National University of Singapore
BIDD – Bioinformatics & Drug Design group (National University / Singapore)
BIND – Biomolecular Interaction Network Database
Bio Balance, Inc.
BIO – Biotechnology Centre of Oslo; Norway EMBnet node
BioActivity – Protein sequence and structure analysis: a practical guide
BIOBASE – Biological Databases
BioCatalogue
BioCentury
Biochemical Society
Biocomputing servers homepages
Biodatabases.com – Biological databases division of Amita Corp.
BioDiscovery, Inc.
Bioexplorer.net
Biofind – Biotechnology industry information, gossip and news
BioFocus – A Galapagos Company
Biogen Idec
BioGPS – The Gene Portal Hub
BioGRID – General Repository for Interaction Dataset
Biohealthmatics.com – career and job search networking site for biomedical informatics professionals
Bioinformatics
Bioinformatics & Research Computing at Whitehead Institute
Bioinformatics companies
Bioinformatics journals and newsletters
Bioinformatik.de – Web directory for bioinformatics
BioInformer – EBI’s newsletter
Bio-IT World – Technology for the Life Sciences
BioJava Project – International association of developers of Java tools for bioinformatics
BioLaboratorio
Biological journals and publishers
Biological software and databases catalog servers
Biology Reference
BioMagResBank – Repository for data on proteins, peptides, and nucleic acids from NMR spectroscopy
BIOMDatabase – Database of mutations causing tetrahydrobiopterin deficiencies
BioMed Central – The Open Access Publisher
Biomedical Computing, Inc.
BioMedSearch – an enhanced version of the NIH PubMed/MedLine search
BioMint – Mining the Biomedical Literature
BioNetbook – Institut Pasteur gateway to biosites
Bioperl Project – International association of developers of Perl tools for bioinformatics
Bioplanet – The bioinformatics homepage
Bioportfolio – Gateways to biobusiness
BIOPPS – Science & Technology Biocluster de Mexico
BioPur AG – Proteins – Enzymes – Reagents
Biopython Project – International association of developers of Python tools for bioinformatics
Bio-Rad Laboratories, Inc.
Biosci Register – The Online Biotech Buyer’s Guide
BioScientifica Ltd
BIOSIS -at Thomson Reuters Science
BIOSOFT
BioSpectrum Asia Edition – News & Jobs
BioSupplyUK
Biosyn Gizmo – bundle of databases (siRNA, protein, peptide antigen) and tools
Bio-Synthesis Inc
BioSystematica – Gel Imagers & Gel Analysis
Biotaq.com
BioTech
Biotech Industry Supplier Registry
BioTech – Life Sciences Resources and Reference Tools
Biotechnology and pharmaceutical companies
Biotechnology trade journals
Biotechnology – National Agricultural Library – Biotechnology
BioTech’s life science dictionary
BioTools
BioTools, Inc.
Biotrofix
BioVisioN GmbH
BioWorld Online
Biowww.net
Birkhauser Verlag Basel
BITS – Bioinformatics Information Technology and Systems
Blackwell Munksgaard
Blackwell Publishing – has joined the Wiley Group
BLMbase – Human BLM mutation Database (Bloom syndrome)
BLOCKS – BLOCKS Database
Blood group antigens in UniProtKB/Swiss-Prot
BMC – BioMedical Centre at Uppsala; Sweden EMBnet node
BMERC – Biomolecular Engineering Research Center
BMJ Group – British Medical Journal publishing group
BMM Domain Fishing – Biomolecular Modelling Laboratory (ICRF) protein domain fishing
BMM – Biomolecular Modelling laboratory at ICRF (London / U.K.)
Bordetella species genome projects at Sanger Institute – bronchiseptica strain RB50, parapertussis strain 1822 and pertussis strain Tohama I
BoviList – Mycobacterium bovis strain AF2122/97 GenoList browser at Institut Pasteur
BOVMAP – Bovine genome Database (in France)
BPGD – Bacterial polysaccharide gene Database
Brassica Genome Gateway
BRENDA – Database of enzyme functional data
BRIC – Biological Research Information Center (Korea)
Briefings in Bioinformatics
British Library
BROAD Institute
Brucella abortus strain 2308 UniProtKB/Swiss-Prot entries, gene names and WWW servers
Brucella abortus strain 9-941 UniProtKB/Swiss-Prot entries, gene names and WWW servers
Brucella melitensis strain 16M UniProtKB/Swiss-Prot entries, gene names and WWW servers
Brucella suis strain 1330 UniProtKB/Swiss-Prot entries, gene names and WWW servers
BSA – Botanical Society of America
BSM – Biomolecular Structure and Modelling group at UCL (London / U.K.)
BTC – BioSpecifics Technology Corp.
BTKbase – Human BTK mutation Database (X-linked agammaglobulinemia)
BuruList – Mycobacterium ulcerans strain Agy99 GenoList browser at Institut Pasteur
BY National Genetics Institute

Sars Cov2 detection

SARS antibody

39139-100ul SAB 100ul 252 EUR

SARS antibody

70R-20086 Fitzgerald 50 ul 435 EUR
Description: Rabbit polyclonal SARS antibody

SARS antibody

70R-1444 Fitzgerald 100 ug 377 EUR
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 Fitzgerald 100 ug 377 EUR
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS siRNA

20-abx932473 Abbexa
  • 551.00 EUR
  • 732.00 EUR
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474 Abbexa
  • 551.00 EUR
  • 732.00 EUR
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS Antibody

1-CSB-PA04145A0Rb Cusabio
  • 317.00 EUR
  • 335.00 EUR
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU Cusabio
  • 597.00 EUR
  • 333.00 EUR
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pENTR223-SARS

PVT12269 Lifescience Market 2 ug 391 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg EnQuireBio 1mg 1261 EUR

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg EnQuireBio 1mg 3954 EUR

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug EnQuireBio 20ug 201 EUR

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug EnQuireBio 5ug 155 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug EnQuireBio 500ug 663 EUR

SARS Conjugated Antibody

C39139 SAB 100ul 397 EUR

SARS cloning plasmid

CSB-CL020709HU1-10ug Cusabio 10ug 376 EUR
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug Cusabio 10ug 376 EUR
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Protease Substrate

H-5982.0500 Bachem 0.5mg 297 EUR
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 Bachem 1.0mg 515 EUR
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

anti- SARS antibody

FNab07609 FN Test 100µg 548.75 EUR
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: seryl-tRNA synthetase
  • Uniprot ID: P49591
  • Gene ID: 6301
  • Research Area: Metabolism
Description: Antibody raised against SARS

SARS Spike Antibody

20-abx137200 Abbexa
  • 1177.00 EUR
  • 1887.00 EUR
  • 2221.00 EUR
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201 Abbexa
  • 1177.00 EUR
  • 1887.00 EUR
  • 2221.00 EUR
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184 Abbexa
  • 1052.00 EUR
  • 1539.00 EUR
  • 1720.00 EUR
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185 Abbexa
  • 1052.00 EUR
  • 1539.00 EUR
  • 1970.00 EUR
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS-E2 Antibody

abx016055-100ul Abbexa 100 ul 411 EUR
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul Abbexa 100 ul 411 EUR
  • Shipped within 5-10 working days.

SARS Polyclonal Antibody

A53977 EpiGentek 100 µg 570.55 EUR
Description: The best epigenetics products

SARS Rabbit pAb

A13350-100ul Abclonal 100 ul 308 EUR

SARS Rabbit pAb

A13350-200ul Abclonal 200 ul 459 EUR

SARS Rabbit pAb

A13350-20ul Abclonal 20 ul 183 EUR

SARS Rabbit pAb

A13350-50ul Abclonal 50 ul 223 EUR

SARS Rabbit pAb

A6733-100ul Abclonal 100 ul 308 EUR

SARS Rabbit pAb

A6733-200ul Abclonal 200 ul 459 EUR

SARS Rabbit pAb

A6733-20ul Abclonal 20 ul 183 EUR

SARS Rabbit pAb

A6733-50ul Abclonal 50 ul 223 EUR

SARS Blocking Peptide

33R-7048 Fitzgerald 100 ug 180 EUR
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS Blocking Peptide

33R-8713 Fitzgerald 100 ug 180 EUR
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Coronavirus antibody

10C-CR9003M1 Fitzgerald 100 ug 499 EUR
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 Fitzgerald 100 ug 435 EUR
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 Fitzgerald 100 ug 435 EUR
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS E2 antibody

10R-1976 Fitzgerald 100 ul 241 EUR
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 Fitzgerald 100 ul 241 EUR
Description: Mouse monoclonal SARS M antibody

SARS Spike Antibody

24216-100ul SAB 100ul 390 EUR

SARS Spike Antibody

24217-100ul SAB 100ul 390 EUR

SARS Spike Antibody

24218-100ul SAB 100ul 390 EUR

SARS Spike Antibody

24219-100ul SAB 100ul 390 EUR

SARS Spike Antibody

24318-100ul SAB 100ul 390 EUR

SARS Matrix Antibody

24319-100ul SAB 100ul 390 EUR

SARS Matrix Antibody

24320-100ul SAB 100ul 390 EUR

SARS Envelope Antibody

24321-100ul SAB 100ul 390 EUR

SARS Envelope Antibody

24322-100ul SAB 100ul 390 EUR

SARS S1 [His]

DAG1861 Creative Diagnostics 500 ug 2529 EUR

SARS S2 [His]

DAG1862 Creative Diagnostics 500 ug 2529 EUR

Anti-SARS antibody

PAab07609 Lifescience Market 100 ug 386 EUR

Anti-SARS antibody

STJ28816 St John's Laboratory 100 µl 277 EUR
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 St John's Laboratory 100 µl 277 EUR
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 Abfrontier 100 ug 363 EUR
Description: Mouse monoclonal to SARS

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug

QP13420-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg

QP13420-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug

QP13420-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug

QP13421-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg

QP13421-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug

QP13421-500ug EnQuireBio 500ug 663 EUR

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug

QP13422-100ug EnQuireBio 100ug 218 EUR

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg

QP13422-1mg EnQuireBio 1mg 1061 EUR

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug

QP13422-500ug EnQuireBio 500ug 663 EUR

Polyclonal SARS Matrix Antibody

APR11178G Leading Biology 0.1 mg 659 EUR
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Polyclonal SARS Matrix Antibody

APG02976G Leading Biology 0.1 mg 659 EUR
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Rat SARS shRNA Plasmid

20-abx988123 Abbexa
  • 801.00 EUR
  • 1121.00 EUR
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SARS ELISA KIT|Human

EF002719 Lifescience Market 96 Tests 689 EUR

SARS CoV E Protein

abx060650-1mg Abbexa 1 mg 1692 EUR
  • Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein

abx060652-1mg Abbexa 1 mg 1873 EUR
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060653-1mg Abbexa 1 mg 1692 EUR
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060654-1mg Abbexa 1 mg 1692 EUR
  • Shipped within 5-10 working days.

SARS-CoV Spike Protein

abx060655-1mg Abbexa 1 mg 1692 EUR
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul Abbexa 400 ul 523 EUR
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-80l Abbexa 80 µl 286 EUR
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-400ul Abbexa 400 ul 523 EUR
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-80l Abbexa 80 µl 286 EUR
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-400ul Abbexa 400 ul 523 EUR
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-80l Abbexa 80 µl 286 EUR
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018255-100ug Abbexa 100 ug 384 EUR
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug Abbexa 100 ug 384 EUR
  • Shipped within 5-10 working days.

Human SARS shRNA Plasmid

20-abx954245 Abbexa
  • 801.00 EUR
  • 1121.00 EUR
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SARS protein (His tag)

80R-2099 Fitzgerald 50 ug 322 EUR
Description: Recombinant human SARS protein (His tag)

Mouse SARS shRNA Plasmid

20-abx972567 Abbexa
  • 801.00 EUR
  • 1121.00 EUR
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SARS Antibody, HRP conjugated

1-CSB-PA04145B0Rb Cusabio
  • 317.00 EUR
  • 335.00 EUR
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

1-CSB-PA04145C0Rb Cusabio
  • 317.00 EUR
  • 335.00 EUR
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

1-CSB-PA04145D0Rb Cusabio
  • 317.00 EUR
  • 335.00 EUR
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti-SARS-E2 (4A6C9)

LF-MA30016 Abfrontier 100 ul 344 EUR
Description: Mouse Monoclonal to SARS-E2

anti-SARS-M (2H2C4)

LF-MA30017 Abfrontier 100 ul 354 EUR
Description: Mouse Monoclonal to SARS-M

SARS Recombinant Protein (Human)

RP027604 ABM 100 ug Ask for price

SARS Recombinant Protein (Human)

RP027607 ABM 100 ug Ask for price

SARS Recombinant Protein (Rat)

RP227480 ABM 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170009 ABM 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170012 ABM 100 ug Ask for price

Anti-SARS-E2 antibody

STJ98377 St John's Laboratory 100 µl 234 EUR
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody

STJ98378 St John's Laboratory 100 µl 234 EUR
Description: Mouse monoclonal to SARS-M.

Recombinant SARS Matrix Protein

VAng-Lsx0059-inquire Creative Biolabs inquire Ask for price
Description: SARS Matrix, recombinant protein from E. coli.

SARS-CoV spike protein Antibody

abx023139-100ug Abbexa 100 ug 857 EUR
  • Shipped within 5-10 working days.

SARS-CoV spike protein Antibody

abx023143-100ug Abbexa 100 ug 857 EUR
  • Shipped within 5-10 working days.

SARS Associated Coronavirus Matrix Protein

20-abx260150 Abbexa
  • 885.00 EUR
  • 342.00 EUR
  • 1372.00 EUR
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

SARS Associated Coronavirus Envelope Protein

20-abx260151 Abbexa
  • 885.00 EUR
  • 342.00 EUR
  • 1372.00 EUR
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

SARS Polyclonal Antibody, HRP Conjugated

A53978 EpiGentek 100 µg 570.55 EUR
Description: kits suitable for this type of research

SARS Polyclonal Antibody, FITC Conjugated

A53979 EpiGentek 100 µg 570.55 EUR
Description: fast delivery possible

SARS Polyclonal Antibody, Biotin Conjugated

A53980 EpiGentek 100 µg 570.55 EUR
Description: reagents widely cited

Recombinant SARS Associated Coronavirus Matrix

7-07114 CHI Scientific 100µg Ask for price

Recombinant SARS Associated Coronavirus Matrix

7-07115 CHI Scientific 500µg Ask for price

Recombinant SARS Associated Coronavirus Matrix

7-07116 CHI Scientific 1000µg Ask for price